\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0207096735:

Variant ID: vg0207096735 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 7096735
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATGTGATGTTGGGTATGTTTAGATTCATTATGCTATAAAATGTCTTATCTTATCTTTTATGAAACAGAGGAAGTAGTAATAAGCCATAGGTGTATGCCC[T/C]
GTGTTTAGAAAACCGATGAAAACCGGTGAAATCCAAACTTTCTTGACCAGGTCAGAAAGCTACAAACTACTCGGTCTTTTGGTCAAGTTTAAAATTTTCA

Reverse complement sequence

TGAAAATTTTAAACTTGACCAAAAGACCGAGTAGTTTGTAGCTTTCTGACCTGGTCAAGAAAGTTTGGATTTCACCGGTTTTCATCGGTTTTCTAAACAC[A/G]
GGGCATACACCTATGGCTTATTACTACTTCCTCTGTTTCATAAAAGATAAGATAAGACATTTTATAGCATAATGAATCTAAACATACCCAACATCACATC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.90% 23.10% 0.00% 0.00% NA
All Indica  2759 70.90% 29.10% 0.00% 0.00% NA
All Japonica  1512 98.70% 1.30% 0.00% 0.00% NA
Aus  269 32.70% 67.30% 0.00% 0.00% NA
Indica I  595 61.20% 38.80% 0.00% 0.00% NA
Indica II  465 74.60% 25.40% 0.00% 0.00% NA
Indica III  913 80.20% 19.80% 0.00% 0.00% NA
Indica Intermediate  786 65.10% 34.90% 0.00% 0.00% NA
Temperate Japonica  767 99.30% 0.70% 0.00% 0.00% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 2.90% 0.00% 0.00% NA
VI/Aromatic  96 34.40% 65.60% 0.00% 0.00% NA
Intermediate  90 73.30% 26.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0207096735 T -> C LOC_Os02g13310.1 upstream_gene_variant ; 215.0bp to feature; MODIFIER silent_mutation Average:73.486; most accessible tissue: Callus, score: 97.649 N N N N
vg0207096735 T -> C LOC_Os02g13304-LOC_Os02g13310 intergenic_region ; MODIFIER silent_mutation Average:73.486; most accessible tissue: Callus, score: 97.649 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0207096735 T C -0.01 0.02 0.01 0.01 0.03 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0207096735 NA 1.99E-07 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207096735 NA 6.22E-06 mr1431_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207096735 NA 3.05E-09 mr1743_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207096735 NA 4.15E-06 mr1756_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251