\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0207043918:

Variant ID: vg0207043918 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 7043918
Reference Allele: AAlternative Allele: C,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCAATAATTGAATATATTTTCATAATAAATTAGGTTGAAAATGTTATTATTTTTTCTACAAACTTAGTTAAACTTGAAGTAGTTTAACTTCGATCAAAGT[A/C,T]
AAAAACATAACCTGCTGCGACGGAGGCAGTACATGACTTTATTTTGAGGTTGCCTGACAGTGCCAGCTACTCCAGCTAGCTATTGTCTGCTTTCGTATTG

Reverse complement sequence

CAATACGAAAGCAGACAATAGCTAGCTGGAGTAGCTGGCACTGTCAGGCAACCTCAAAATAAAGTCATGTACTGCCTCCGTCGCAGCAGGTTATGTTTTT[T/G,A]
ACTTTGATCGAAGTTAAACTACTTCAAGTTTAACTAAGTTTGTAGAAAAAATAATAACATTTTCAACCTAATTTATTATGAAAATATATTCAATTATTGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.80% 12.80% 0.08% 4.19% T: 0.11%
All Indica  2759 95.30% 0.50% 0.00% 3.99% T: 0.18%
All Japonica  1512 61.20% 38.20% 0.26% 0.26% NA
Aus  269 69.90% 0.70% 0.00% 29.37% NA
Indica I  595 86.60% 0.70% 0.00% 12.77% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 98.60% 0.20% 0.00% 0.66% T: 0.55%
Indica Intermediate  786 96.10% 0.40% 0.00% 3.56% NA
Temperate Japonica  767 31.00% 68.40% 0.00% 0.52% NA
Tropical Japonica  504 95.40% 3.80% 0.79% 0.00% NA
Japonica Intermediate  241 85.90% 14.10% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 83.30% 11.10% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0207043918 A -> T LOC_Os02g13210.1 upstream_gene_variant ; 973.0bp to feature; MODIFIER silent_mutation Average:52.991; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0207043918 A -> T LOC_Os02g13220.1 downstream_gene_variant ; 699.0bp to feature; MODIFIER silent_mutation Average:52.991; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0207043918 A -> T LOC_Os02g13210-LOC_Os02g13220 intergenic_region ; MODIFIER silent_mutation Average:52.991; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0207043918 A -> DEL N N silent_mutation Average:52.991; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0207043918 A -> C LOC_Os02g13210.1 upstream_gene_variant ; 973.0bp to feature; MODIFIER silent_mutation Average:52.991; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0207043918 A -> C LOC_Os02g13220.1 downstream_gene_variant ; 699.0bp to feature; MODIFIER silent_mutation Average:52.991; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0207043918 A -> C LOC_Os02g13210-LOC_Os02g13220 intergenic_region ; MODIFIER silent_mutation Average:52.991; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0207043918 NA 1.05E-13 Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0207043918 NA 1.95E-09 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207043918 NA 1.10E-10 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207043918 NA 3.16E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207043918 4.13E-06 1.28E-08 mr1053_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207043918 4.81E-07 2.63E-08 mr1128_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207043918 2.91E-06 2.04E-08 mr1147_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207043918 NA 6.54E-07 mr1204_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207043918 NA 9.28E-10 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251