| Variant ID: vg0207043918 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 7043918 |
| Reference Allele: A | Alternative Allele: C,T |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCAATAATTGAATATATTTTCATAATAAATTAGGTTGAAAATGTTATTATTTTTTCTACAAACTTAGTTAAACTTGAAGTAGTTTAACTTCGATCAAAGT[A/C,T]
AAAAACATAACCTGCTGCGACGGAGGCAGTACATGACTTTATTTTGAGGTTGCCTGACAGTGCCAGCTACTCCAGCTAGCTATTGTCTGCTTTCGTATTG
CAATACGAAAGCAGACAATAGCTAGCTGGAGTAGCTGGCACTGTCAGGCAACCTCAAAATAAAGTCATGTACTGCCTCCGTCGCAGCAGGTTATGTTTTT[T/G,A]
ACTTTGATCGAAGTTAAACTACTTCAAGTTTAACTAAGTTTGTAGAAAAAATAATAACATTTTCAACCTAATTTATTATGAAAATATATTCAATTATTGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.80% | 12.80% | 0.08% | 4.19% | T: 0.11% |
| All Indica | 2759 | 95.30% | 0.50% | 0.00% | 3.99% | T: 0.18% |
| All Japonica | 1512 | 61.20% | 38.20% | 0.26% | 0.26% | NA |
| Aus | 269 | 69.90% | 0.70% | 0.00% | 29.37% | NA |
| Indica I | 595 | 86.60% | 0.70% | 0.00% | 12.77% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.60% | 0.20% | 0.00% | 0.66% | T: 0.55% |
| Indica Intermediate | 786 | 96.10% | 0.40% | 0.00% | 3.56% | NA |
| Temperate Japonica | 767 | 31.00% | 68.40% | 0.00% | 0.52% | NA |
| Tropical Japonica | 504 | 95.40% | 3.80% | 0.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 85.90% | 14.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 11.10% | 0.00% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0207043918 | A -> T | LOC_Os02g13210.1 | upstream_gene_variant ; 973.0bp to feature; MODIFIER | silent_mutation | Average:52.991; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| vg0207043918 | A -> T | LOC_Os02g13220.1 | downstream_gene_variant ; 699.0bp to feature; MODIFIER | silent_mutation | Average:52.991; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| vg0207043918 | A -> T | LOC_Os02g13210-LOC_Os02g13220 | intergenic_region ; MODIFIER | silent_mutation | Average:52.991; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| vg0207043918 | A -> DEL | N | N | silent_mutation | Average:52.991; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| vg0207043918 | A -> C | LOC_Os02g13210.1 | upstream_gene_variant ; 973.0bp to feature; MODIFIER | silent_mutation | Average:52.991; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| vg0207043918 | A -> C | LOC_Os02g13220.1 | downstream_gene_variant ; 699.0bp to feature; MODIFIER | silent_mutation | Average:52.991; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| vg0207043918 | A -> C | LOC_Os02g13210-LOC_Os02g13220 | intergenic_region ; MODIFIER | silent_mutation | Average:52.991; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0207043918 | NA | 1.05E-13 | Grain_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0207043918 | NA | 1.95E-09 | mr1137 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207043918 | NA | 1.10E-10 | mr1486 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207043918 | NA | 3.16E-07 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207043918 | 4.13E-06 | 1.28E-08 | mr1053_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207043918 | 4.81E-07 | 2.63E-08 | mr1128_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207043918 | 2.91E-06 | 2.04E-08 | mr1147_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207043918 | NA | 6.54E-07 | mr1204_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0207043918 | NA | 9.28E-10 | mr1530_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |