\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0207019221:

Variant ID: vg0207019221 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 7019221
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCGCATGGGTTTTTCAGGTTGGCGCATGTCAAGTGCCGCAGTGAATGGATTGGCTGGTGCCGGTGGTGGCATCATCGCCCAGATCATCACCTACCCCCT[C/T]
CAGACCGTACGTACAATCATTCTTCCCTTACCATCTTATGTAGATATGAACAAGATAGATCAATATGTAATATATCAATCCACAAACATGCAAGTTGAAA

Reverse complement sequence

TTTCAACTTGCATGTTTGTGGATTGATATATTACATATTGATCTATCTTGTTCATATCTACATAAGATGGTAAGGGAAGAATGATTGTACGTACGGTCTG[G/A]
AGGGGGTAGGTGATGATCTGGGCGATGATGCCACCACCGGCACCAGCCAATCCATTCACTGCGGCACTTGACATGCGCCAACCTGAAAAACCCATGCGCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.40% 22.10% 5.92% 16.53% NA
All Indica  2759 82.30% 1.50% 5.40% 10.80% NA
All Japonica  1512 3.20% 63.20% 6.48% 27.05% NA
Aus  269 67.30% 3.30% 7.43% 21.93% NA
Indica I  595 87.10% 0.80% 4.37% 7.73% NA
Indica II  465 88.80% 0.60% 2.58% 7.96% NA
Indica III  913 82.00% 2.00% 5.81% 10.19% NA
Indica Intermediate  786 75.20% 1.90% 7.38% 15.52% NA
Temperate Japonica  767 1.70% 89.70% 1.56% 7.04% NA
Tropical Japonica  504 4.60% 32.30% 12.50% 50.60% NA
Japonica Intermediate  241 5.40% 43.60% 9.54% 41.49% NA
VI/Aromatic  96 70.80% 21.90% 3.12% 4.17% NA
Intermediate  90 55.60% 21.10% 11.11% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0207019221 C -> T LOC_Os02g13170.1 synonymous_variant ; p.Leu272Leu; LOW synonymous_codon Average:74.943; most accessible tissue: Minghui63 flag leaf, score: 89.224 N N N N
vg0207019221 C -> DEL LOC_Os02g13170.1 N frameshift_variant Average:74.943; most accessible tissue: Minghui63 flag leaf, score: 89.224 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0207019221 NA 1.00E-07 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221 NA 6.58E-06 mr1291 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221 NA 4.38E-11 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221 1.22E-06 8.19E-08 mr1532 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221 NA 3.75E-09 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221 NA 2.32E-06 mr1608 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221 NA 2.34E-06 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221 NA 5.82E-24 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221 NA 1.12E-07 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221 NA 6.52E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221 NA 1.02E-08 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221 NA 5.73E-15 mr1258_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221 NA 2.05E-10 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221 NA 7.65E-06 mr1400_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221 NA 4.39E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221 NA 1.64E-09 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221 NA 5.53E-08 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221 NA 2.85E-14 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221 NA 1.16E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221 NA 1.30E-13 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221 NA 4.29E-06 mr1743_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221 NA 4.10E-15 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221 NA 1.68E-10 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221 NA 1.52E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221 NA 4.54E-14 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221 NA 3.10E-08 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221 NA 3.57E-08 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221 NA 6.23E-13 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221 NA 1.20E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251