Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0207019221:

Variant ID: vg0207019221 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 7019221
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGCGCATGGGTTTTTCAGGTTGGCGCATGTCAAGTGCCGCAGTGAATGGATTGGCTGGTGCCGGTGGTGGCATCATCGCCCAGATCATCACCTACCCCCT[C/T]
CAGACCGTACGTACAATCATTCTTCCCTTACCATCTTATGTAGATATGAACAAGATAGATCAATATGTAATATATCAATCCACAAACATGCAAGTTGAAA

Reverse complement sequence

TTTCAACTTGCATGTTTGTGGATTGATATATTACATATTGATCTATCTTGTTCATATCTACATAAGATGGTAAGGGAAGAATGATTGTACGTACGGTCTG[G/A]
AGGGGGTAGGTGATGATCTGGGCGATGATGCCACCACCGGCACCAGCCAATCCATTCACTGCGGCACTTGACATGCGCCAACCTGAAAAACCCATGCGCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.40%	22.10%	5.92%	16.53%	NA
All Indica	2759	82.30%	1.50%	5.40%	10.80%	NA
All Japonica	1512	3.20%	63.20%	6.48%	27.05%	NA
Aus	269	67.30%	3.30%	7.43%	21.93%	NA
Indica I	595	87.10%	0.80%	4.37%	7.73%	NA
Indica II	465	88.80%	0.60%	2.58%	7.96%	NA
Indica III	913	82.00%	2.00%	5.81%	10.19%	NA
Indica Intermediate	786	75.20%	1.90%	7.38%	15.52%	NA
Temperate Japonica	767	1.70%	89.70%	1.56%	7.04%	NA
Tropical Japonica	504	4.60%	32.30%	12.50%	50.60%	NA
Japonica Intermediate	241	5.40%	43.60%	9.54%	41.49%	NA
VI/Aromatic	96	70.80%	21.90%	3.12%	4.17%	NA
Intermediate	90	55.60%	21.10%	11.11%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0207019221	C -> T	LOC_Os02g13170.1	synonymous_variant ; p.Leu272Leu; LOW	synonymous_codon	Average:74.943; most accessible tissue: Minghui63 flag leaf, score: 89.224	N	N	N	N
vg0207019221	C -> DEL	LOC_Os02g13170.1	N	frameshift_variant	Average:74.943; most accessible tissue: Minghui63 flag leaf, score: 89.224	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0207019221	NA	1.00E-07	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221	NA	6.58E-06	mr1291	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221	NA	4.38E-11	mr1379	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221	1.22E-06	8.19E-08	mr1532	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221	NA	3.75E-09	mr1578	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221	NA	2.32E-06	mr1608	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221	NA	2.34E-06	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221	NA	5.82E-24	mr1888	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221	NA	1.12E-07	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221	NA	6.52E-06	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221	NA	1.02E-08	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221	NA	5.73E-15	mr1258_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221	NA	2.05E-10	mr1338_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221	NA	7.65E-06	mr1400_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221	NA	4.39E-07	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221	NA	1.64E-09	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221	NA	5.53E-08	mr1604_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221	NA	2.85E-14	mr1636_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221	NA	1.16E-07	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221	NA	1.30E-13	mr1714_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221	NA	4.29E-06	mr1743_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221	NA	4.10E-15	mr1767_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221	NA	1.68E-10	mr1806_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221	NA	1.52E-07	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221	NA	4.54E-14	mr1838_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221	NA	3.10E-08	mr1909_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221	NA	3.57E-08	mr1921_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221	NA	6.23E-13	mr1986_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0207019221	NA	1.20E-06	mr1992_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251