\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0206843146:

Variant ID: vg0206843146 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 6843146
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.56, T: 0.44, others allele: 0.00, population size: 32. )

Flanking Sequence (100 bp) in Reference Genome:


GCATGCAATGATGAACATCCTACTTGTGATTATGCCATGCCTTGATTATTGTTTACCCTTAAATCCTTGTAACCATGATTACGTATGAATCCCTAGTCTA[T/C]
TAGGACAAATGCTTAGAAATGCTACTCTAGATTCATGCATACTCATATTTATCGAATACTATATGCTTGGGTAATTACCTTTGGGAAGGTAATTGAGATG

Reverse complement sequence

CATCTCAATTACCTTCCCAAAGGTAATTACCCAAGCATATAGTATTCGATAAATATGAGTATGCATGAATCTAGAGTAGCATTTCTAAGCATTTGTCCTA[A/G]
TAGACTAGGGATTCATACGTAATCATGGTTACAAGGATTTAAGGGTAAACAATAATCAAGGCATGGCATAATCACAAGTAGGATGTTCATCATTGCATGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 23.90% 21.90% 0.95% 53.24% NA
All Indica  2759 7.80% 1.90% 1.59% 88.76% NA
All Japonica  1512 36.30% 62.00% 0.07% 1.59% NA
Aus  269 98.50% 0.70% 0.00% 0.74% NA
Indica I  595 0.50% 1.50% 0.17% 97.82% NA
Indica II  465 14.80% 2.60% 1.94% 80.65% NA
Indica III  913 5.40% 0.80% 2.19% 91.68% NA
Indica Intermediate  786 11.80% 3.10% 1.78% 83.33% NA
Temperate Japonica  767 9.00% 89.20% 0.13% 1.69% NA
Tropical Japonica  504 67.70% 31.20% 0.00% 1.19% NA
Japonica Intermediate  241 57.70% 40.20% 0.00% 2.07% NA
VI/Aromatic  96 77.10% 20.80% 0.00% 2.08% NA
Intermediate  90 31.10% 25.60% 0.00% 43.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0206843146 T -> DEL N N silent_mutation Average:15.026; most accessible tissue: Minghui63 root, score: 35.002 N N N N
vg0206843146 T -> C LOC_Os02g12950.1 upstream_gene_variant ; 2131.0bp to feature; MODIFIER silent_mutation Average:15.026; most accessible tissue: Minghui63 root, score: 35.002 N N N N
vg0206843146 T -> C LOC_Os02g12939-LOC_Os02g12950 intergenic_region ; MODIFIER silent_mutation Average:15.026; most accessible tissue: Minghui63 root, score: 35.002 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0206843146 NA 5.63E-07 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206843146 NA 3.39E-06 mr1044 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206843146 NA 2.82E-06 mr1045 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206843146 NA 2.04E-07 mr1195 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206843146 NA 7.03E-07 mr1295 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206843146 9.84E-07 6.90E-08 mr1482 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206843146 NA 1.53E-08 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206843146 NA 6.52E-07 mr1614 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206843146 NA 9.59E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206843146 NA 1.61E-15 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206843146 NA 1.57E-13 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206843146 NA 2.11E-06 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251