\
| Variant ID: vg0206843146 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 6843146 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.56, T: 0.44, others allele: 0.00, population size: 32. )
GCATGCAATGATGAACATCCTACTTGTGATTATGCCATGCCTTGATTATTGTTTACCCTTAAATCCTTGTAACCATGATTACGTATGAATCCCTAGTCTA[T/C]
TAGGACAAATGCTTAGAAATGCTACTCTAGATTCATGCATACTCATATTTATCGAATACTATATGCTTGGGTAATTACCTTTGGGAAGGTAATTGAGATG
CATCTCAATTACCTTCCCAAAGGTAATTACCCAAGCATATAGTATTCGATAAATATGAGTATGCATGAATCTAGAGTAGCATTTCTAAGCATTTGTCCTA[A/G]
TAGACTAGGGATTCATACGTAATCATGGTTACAAGGATTTAAGGGTAAACAATAATCAAGGCATGGCATAATCACAAGTAGGATGTTCATCATTGCATGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 23.90% | 21.90% | 0.95% | 53.24% | NA |
| All Indica | 2759 | 7.80% | 1.90% | 1.59% | 88.76% | NA |
| All Japonica | 1512 | 36.30% | 62.00% | 0.07% | 1.59% | NA |
| Aus | 269 | 98.50% | 0.70% | 0.00% | 0.74% | NA |
| Indica I | 595 | 0.50% | 1.50% | 0.17% | 97.82% | NA |
| Indica II | 465 | 14.80% | 2.60% | 1.94% | 80.65% | NA |
| Indica III | 913 | 5.40% | 0.80% | 2.19% | 91.68% | NA |
| Indica Intermediate | 786 | 11.80% | 3.10% | 1.78% | 83.33% | NA |
| Temperate Japonica | 767 | 9.00% | 89.20% | 0.13% | 1.69% | NA |
| Tropical Japonica | 504 | 67.70% | 31.20% | 0.00% | 1.19% | NA |
| Japonica Intermediate | 241 | 57.70% | 40.20% | 0.00% | 2.07% | NA |
| VI/Aromatic | 96 | 77.10% | 20.80% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 31.10% | 25.60% | 0.00% | 43.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0206843146 | T -> DEL | N | N | silent_mutation | Average:15.026; most accessible tissue: Minghui63 root, score: 35.002 | N | N | N | N |
| vg0206843146 | T -> C | LOC_Os02g12950.1 | upstream_gene_variant ; 2131.0bp to feature; MODIFIER | silent_mutation | Average:15.026; most accessible tissue: Minghui63 root, score: 35.002 | N | N | N | N |
| vg0206843146 | T -> C | LOC_Os02g12939-LOC_Os02g12950 | intergenic_region ; MODIFIER | silent_mutation | Average:15.026; most accessible tissue: Minghui63 root, score: 35.002 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0206843146 | NA | 5.63E-07 | mr1029 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206843146 | NA | 3.39E-06 | mr1044 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206843146 | NA | 2.82E-06 | mr1045 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206843146 | NA | 2.04E-07 | mr1195 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206843146 | NA | 7.03E-07 | mr1295 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206843146 | 9.84E-07 | 6.90E-08 | mr1482 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206843146 | NA | 1.53E-08 | mr1530 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206843146 | NA | 6.52E-07 | mr1614 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206843146 | NA | 9.59E-06 | mr1625 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206843146 | NA | 1.61E-15 | mr1530_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206843146 | NA | 1.57E-13 | mr1552_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206843146 | NA | 2.11E-06 | mr1730_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |