\
| Variant ID: vg0206815673 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 6815673 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 345. )
CTCAAGAACCTCACCCACTTGGATGTCTCCTACAACAACATATCCTCTCCATTCCCTACAATGCTCTACAATTGCTCCAATCTCAAGTACCTTGACCTTT[C/T]
GAACAACGCCTTTGCTGGGAAGCTCCCAAATGATATAAATAGTCTACCAGCGCTGCTCGAGCATCTCAACCTTTCATCTAATCACTTCACTGGCAGAATT
AATTCTGCCAGTGAAGTGATTAGATGAAAGGTTGAGATGCTCGAGCAGCGCTGGTAGACTATTTATATCATTTGGGAGCTTCCCAGCAAAGGCGTTGTTC[G/A]
AAAGGTCAAGGTACTTGAGATTGGAGCAATTGTAGAGCATTGTAGGGAATGGAGAGGATATGTTGTTGTAGGAGACATCCAAGTGGGTGAGGTTCTTGAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.50% | 1.00% | 2.73% | 7.79% | NA |
| All Indica | 2759 | 99.90% | 0.00% | 0.00% | 0.14% | NA |
| All Japonica | 1512 | 65.90% | 3.00% | 8.13% | 22.88% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.00% | 0.37% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.00% | 0.00% | 0.22% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.00% | 0.00% | 0.38% | NA |
| Temperate Japonica | 767 | 92.00% | 0.90% | 2.48% | 4.56% | NA |
| Tropical Japonica | 504 | 34.70% | 4.80% | 14.48% | 46.03% | NA |
| Japonica Intermediate | 241 | 48.10% | 6.20% | 12.86% | 32.78% | NA |
| VI/Aromatic | 96 | 89.60% | 0.00% | 1.04% | 9.38% | NA |
| Intermediate | 90 | 84.40% | 1.10% | 5.56% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0206815673 | C -> T | LOC_Os02g12910.1 | missense_variant ; p.Ser128Leu; MODERATE | nonsynonymous_codon ; S128L | Average:66.707; most accessible tissue: Minghui63 flag leaf, score: 84.608 | possibly damaging |
1.746 |
DELETERIOUS | 0.03 |
| vg0206815673 | C -> DEL | LOC_Os02g12910.1 | N | frameshift_variant | Average:66.707; most accessible tissue: Minghui63 flag leaf, score: 84.608 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0206815673 | NA | 2.92E-13 | mr1449 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206815673 | NA | 1.88E-09 | mr1668 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206815673 | NA | 5.51E-10 | mr1398_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206815673 | NA | 6.00E-06 | mr1398_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206815673 | NA | 3.73E-16 | mr1552_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206815673 | 3.75E-07 | NA | mr1563_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206815673 | NA | 1.18E-06 | mr1730_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |