\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0206770823:

Variant ID: vg0206770823 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 6770823
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTGCCACAACCCCACCAAATACGACAATCAAACGGAAACTTTCGTGTTTTTTTTAAATACGATGATCAAAAGAGAACAGAGAGAATATGATAAATTAAA[T/C]
AGCTTACCATTATCTAAAAAAAACAGCTTATAAAACCCAATAAGTACTCAAGACTCAAGAGGCAGTCTCAGCCTATTTTTCCTTTCCTTTCATTCAAGGA

Reverse complement sequence

TCCTTGAATGAAAGGAAAGGAAAAATAGGCTGAGACTGCCTCTTGAGTCTTGAGTACTTATTGGGTTTTATAAGCTGTTTTTTTTAGATAATGGTAAGCT[A/G]
TTTAATTTATCATATTCTCTCTGTTCTCTTTTGATCATCGTATTTAAAAAAAACACGAAAGTTTCCGTTTGATTGTCGTATTTGGTGGGGTTGTGGCAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.10% 44.90% 0.08% 0.00% NA
All Indica  2759 91.70% 8.30% 0.04% 0.00% NA
All Japonica  1512 1.70% 98.30% 0.00% 0.00% NA
Aus  269 0.70% 99.30% 0.00% 0.00% NA
Indica I  595 98.70% 1.30% 0.00% 0.00% NA
Indica II  465 83.90% 16.10% 0.00% 0.00% NA
Indica III  913 94.70% 5.10% 0.11% 0.00% NA
Indica Intermediate  786 87.50% 12.50% 0.00% 0.00% NA
Temperate Japonica  767 1.80% 98.20% 0.00% 0.00% NA
Tropical Japonica  504 1.20% 98.80% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 46.70% 50.00% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0206770823 T -> C LOC_Os02g12840.1 upstream_gene_variant ; 490.0bp to feature; MODIFIER silent_mutation Average:61.271; most accessible tissue: Callus, score: 87.125 N N N N
vg0206770823 T -> C LOC_Os02g12830-LOC_Os02g12840 intergenic_region ; MODIFIER silent_mutation Average:61.271; most accessible tissue: Callus, score: 87.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0206770823 NA 9.77E-06 mr1045 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206770823 NA 4.23E-15 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206770823 NA 1.76E-07 mr1195 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206770823 NA 2.69E-09 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206770823 4.19E-06 4.19E-06 mr1360 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206770823 NA 3.83E-06 mr1482 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206770823 3.85E-06 6.82E-08 mr1614 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206770823 NA 3.84E-06 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206770823 NA 3.50E-09 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206770823 NA 3.23E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206770823 NA 1.40E-23 mr1943 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206770823 NA 3.44E-55 mr1109_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206770823 NA 4.73E-17 mr1457_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206770823 NA 5.34E-07 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206770823 NA 3.22E-24 mr1916_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251