Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0206761761:

Variant ID: vg0206761761 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 6761761
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:

TTAGTACAGCCATATAACAACAGGTGTTGGGGGGGGGGGGGGGGGGGTTGGCCCCCTCCGGCACCGCACAGCTGTGCCACTGTATAGCAAAGCTTGGACA[A/G]
CCACGTTTCCCAAGGCTAGAAAGACTTAATTAGTCACATATGAACTAGCTGTATTTGAATTTGGACAACTTTAAATGAGATAGATAGGATGCTTCAACTA

Reverse complement sequence

TAGTTGAAGCATCCTATCTATCTCATTTAAAGTTGTCCAAATTCAAATACAGCTAGTTCATATGTGACTAATTAAGTCTTTCTAGCCTTGGGAAACGTGG[T/C]
TGTCCAAGCTTTGCTATACAGTGGCACAGCTGTGCGGTGCCGGAGGGGGCCAACCCCCCCCCCCCCCCCCCCAACACCTGTTGTTATATGGCTGTACTAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.00%	8.40%	3.55%	23.09%	NA
All Indica	2759	42.00%	14.00%	5.98%	38.09%	NA
All Japonica	1512	98.50%	0.30%	0.00%	1.12%	NA
Aus	269	99.60%	0.00%	0.00%	0.37%	NA
Indica I	595	28.10%	4.90%	4.54%	62.52%	NA
Indica II	465	38.70%	26.20%	8.39%	26.67%	NA
Indica III	913	58.30%	13.10%	5.26%	23.33%	NA
Indica Intermediate	786	35.50%	14.50%	6.49%	43.51%	NA
Temperate Japonica	767	98.30%	0.30%	0.00%	1.43%	NA
Tropical Japonica	504	99.20%	0.20%	0.00%	0.60%	NA
Japonica Intermediate	241	97.90%	0.80%	0.00%	1.24%	NA
VI/Aromatic	96	97.90%	0.00%	0.00%	2.08%	NA
Intermediate	90	66.70%	7.80%	3.33%	22.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0206761761	A -> G	LOC_Os02g12830-LOC_Os02g12840	intergenic_region ; MODIFIER	silent_mutation	Average:33.842; most accessible tissue: Callus, score: 61.478	N	N	N	N
vg0206761761	A -> DEL	N	N	silent_mutation	Average:33.842; most accessible tissue: Callus, score: 61.478	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0206761761	NA	6.27E-06	mr1418	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206761761	4.03E-06	4.03E-06	mr1492	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206761761	1.64E-06	1.64E-06	mr1747	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206761761	5.28E-06	4.52E-06	mr1856	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206761761	NA	3.80E-06	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206761761	NA	9.66E-07	mr1559_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206761761	NA	2.28E-06	mr1929_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251