\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0206576520:

Variant ID: vg0206576520 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 6576520
Reference Allele: GAAlternative Allele: AA,G
Primary Allele: GASecondary Allele: AA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AACAACGAAACAGTCTCCACTGAGTAGTAGCCACGGTCTGCAATAACAGCCATACGGTAAACGTTATCAACATTAGGAAAGCGAAAATCAATAGAGATGC[GA/AA,G]
AACAAAATTACAGACAGAAATAAACGCAAGCATGAAAAGAATCACACGCCCCATATGCACAGAAATGATGGGATCGCCTTTATAGTTTATAGCATTCCAC

Reverse complement sequence

GTGGAATGCTATAAACTATAAAGGCGATCCCATCATTTCTGTGCATATGGGGCGTGTGATTCTTTTCATGCTTGCGTTTATTTCTGTCTGTAATTTTGTT[TC/TT,C]
GCATCTCTATTGATTTTCGCTTTCCTAATGTTGATAACGTTTACCGTATGGCTGTTATTGCAGACCGTGGCTACTACTCAGTGGAGACTGTTTCGTTGTT

Allele Frequencies:

Populations Population SizeFrequency of GA(primary allele) Frequency of AA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.10% 4.10% 0.02% 0.00% G: 2.71%
All Indica  2759 97.90% 2.00% 0.04% 0.00% NA
All Japonica  1512 91.30% 0.30% 0.00% 0.00% G: 8.40%
Aus  269 54.30% 45.70% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 98.00% 1.90% 0.11% 0.00% NA
Indica Intermediate  786 95.30% 4.70% 0.00% 0.00% NA
Temperate Japonica  767 95.30% 0.00% 0.00% 0.00% G: 4.69%
Tropical Japonica  504 97.00% 0.60% 0.00% 0.00% G: 2.38%
Japonica Intermediate  241 66.40% 0.80% 0.00% 0.00% G: 32.78%
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 94.40% 4.40% 0.00% 0.00% G: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0206576520 GA -> G LOC_Os02g12590.1 upstream_gene_variant ; 2438.0bp to feature; MODIFIER silent_mutation Average:58.098; most accessible tissue: Minghui63 flower, score: 73.71 N N N N
vg0206576520 GA -> G LOC_Os02g12570.1 downstream_gene_variant ; 3986.0bp to feature; MODIFIER silent_mutation Average:58.098; most accessible tissue: Minghui63 flower, score: 73.71 N N N N
vg0206576520 GA -> G LOC_Os02g12580.1 intron_variant ; MODIFIER silent_mutation Average:58.098; most accessible tissue: Minghui63 flower, score: 73.71 N N N N
vg0206576520 GA -> AA LOC_Os02g12590.1 upstream_gene_variant ; 2439.0bp to feature; MODIFIER silent_mutation Average:58.098; most accessible tissue: Minghui63 flower, score: 73.71 N N N N
vg0206576520 GA -> AA LOC_Os02g12570.1 downstream_gene_variant ; 3985.0bp to feature; MODIFIER silent_mutation Average:58.098; most accessible tissue: Minghui63 flower, score: 73.71 N N N N
vg0206576520 GA -> AA LOC_Os02g12580.1 intron_variant ; MODIFIER silent_mutation Average:58.098; most accessible tissue: Minghui63 flower, score: 73.71 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0206576520 NA 1.80E-07 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206576520 NA 1.59E-13 mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206576520 NA 7.57E-06 mr1283 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206576520 NA 6.04E-07 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206576520 6.32E-06 4.83E-08 mr1312 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206576520 NA 5.26E-06 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206576520 NA 1.09E-11 mr1612 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206576520 NA 6.42E-12 mr1649 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206576520 NA 1.25E-06 mr1687 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206576520 NA 3.43E-07 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206576520 NA 5.86E-17 mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206576520 NA 1.93E-08 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206576520 NA 4.04E-06 mr1777 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206576520 NA 1.72E-06 mr1803 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206576520 NA 4.45E-06 mr1931 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206576520 NA 9.99E-06 mr1988 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206576520 NA 6.74E-06 mr1344_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206576520 9.17E-06 NA mr1386_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206576520 NA 2.83E-07 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206576520 1.70E-06 NA mr1904_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251