Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0206576520:

Variant ID: vg0206576520 (JBrowse)	Variation Type: INDEL
Chromosome: chr02	Position: 6576520
Reference Allele: GA	Alternative Allele: AA,G
Primary Allele: GA	Secondary Allele: AA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AACAACGAAACAGTCTCCACTGAGTAGTAGCCACGGTCTGCAATAACAGCCATACGGTAAACGTTATCAACATTAGGAAAGCGAAAATCAATAGAGATGC[GA/AA,G]
AACAAAATTACAGACAGAAATAAACGCAAGCATGAAAAGAATCACACGCCCCATATGCACAGAAATGATGGGATCGCCTTTATAGTTTATAGCATTCCAC

Reverse complement sequence

GTGGAATGCTATAAACTATAAAGGCGATCCCATCATTTCTGTGCATATGGGGCGTGTGATTCTTTTCATGCTTGCGTTTATTTCTGTCTGTAATTTTGTT[TC/TT,C]
GCATCTCTATTGATTTTCGCTTTCCTAATGTTGATAACGTTTACCGTATGGCTGTTATTGCAGACCGTGGCTACTACTCAGTGGAGACTGTTTCGTTGTT

Allele Frequencies:

Populations	Population Size	Frequency of GA(primary allele)	Frequency of AA(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.10%	4.10%	0.02%	0.00%	G: 2.71%
All Indica	2759	97.90%	2.00%	0.04%	0.00%	NA
All Japonica	1512	91.30%	0.30%	0.00%	0.00%	G: 8.40%
Aus	269	54.30%	45.70%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	98.00%	1.90%	0.11%	0.00%	NA
Indica Intermediate	786	95.30%	4.70%	0.00%	0.00%	NA
Temperate Japonica	767	95.30%	0.00%	0.00%	0.00%	G: 4.69%
Tropical Japonica	504	97.00%	0.60%	0.00%	0.00%	G: 2.38%
Japonica Intermediate	241	66.40%	0.80%	0.00%	0.00%	G: 32.78%
VI/Aromatic	96	91.70%	8.30%	0.00%	0.00%	NA
Intermediate	90	94.40%	4.40%	0.00%	0.00%	G: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0206576520	GA -> G	LOC_Os02g12590.1	upstream_gene_variant ; 2438.0bp to feature; MODIFIER	silent_mutation	Average:58.098; most accessible tissue: Minghui63 flower, score: 73.71	N	N	N	N
vg0206576520	GA -> G	LOC_Os02g12570.1	downstream_gene_variant ; 3986.0bp to feature; MODIFIER	silent_mutation	Average:58.098; most accessible tissue: Minghui63 flower, score: 73.71	N	N	N	N
vg0206576520	GA -> G	LOC_Os02g12580.1	intron_variant ; MODIFIER	silent_mutation	Average:58.098; most accessible tissue: Minghui63 flower, score: 73.71	N	N	N	N
vg0206576520	GA -> AA	LOC_Os02g12590.1	upstream_gene_variant ; 2439.0bp to feature; MODIFIER	silent_mutation	Average:58.098; most accessible tissue: Minghui63 flower, score: 73.71	N	N	N	N
vg0206576520	GA -> AA	LOC_Os02g12570.1	downstream_gene_variant ; 3985.0bp to feature; MODIFIER	silent_mutation	Average:58.098; most accessible tissue: Minghui63 flower, score: 73.71	N	N	N	N
vg0206576520	GA -> AA	LOC_Os02g12580.1	intron_variant ; MODIFIER	silent_mutation	Average:58.098; most accessible tissue: Minghui63 flower, score: 73.71	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0206576520	NA	1.80E-07	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206576520	NA	1.59E-13	mr1166	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206576520	NA	7.57E-06	mr1283	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206576520	NA	6.04E-07	mr1286	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206576520	6.32E-06	4.83E-08	mr1312	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206576520	NA	5.26E-06	mr1512	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206576520	NA	1.09E-11	mr1612	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206576520	NA	6.42E-12	mr1649	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206576520	NA	1.25E-06	mr1687	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206576520	NA	3.43E-07	mr1762	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206576520	NA	5.86E-17	mr1765	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206576520	NA	1.93E-08	mr1774	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206576520	NA	4.04E-06	mr1777	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206576520	NA	1.72E-06	mr1803	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206576520	NA	4.45E-06	mr1931	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206576520	NA	9.99E-06	mr1988	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206576520	NA	6.74E-06	mr1344_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206576520	9.17E-06	NA	mr1386_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206576520	NA	2.83E-07	mr1792_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206576520	1.70E-06	NA	mr1904_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251