\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0206499072:

Variant ID: vg0206499072 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 6499072
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGATTTGAAGATTGGAAAACCCTTGTTTTTATCTTCTAGTTTGAAGCTTCTATCTTTGCCTTTTCAATGGGCATAGTCTCAATCTTCGTCATAGTTCTA[A/T]
CCATCATGTATATCAACAGAGATCACTTTATAACCACTTTTAATTCTACCAATTTTTGACATATTTTGTGTTACTAAATTTTGATAGTGTTGGATATGTT

Reverse complement sequence

AACATATCCAACACTATCAAAATTTAGTAACACAAAATATGTCAAAAATTGGTAGAATTAAAAGTGGTTATAAAGTGATCTCTGTTGATATACATGATGG[T/A]
TAGAACTATGACGAAGATTGAGACTATGCCCATTGAAAAGGCAAAGATAGAAGCTTCAAACTAGAAGATAAAAACAAGGGTTTTCCAATCTTCAAATCAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.70% 40.60% 0.13% 9.56% NA
All Indica  2759 29.20% 66.50% 0.04% 4.28% NA
All Japonica  1512 96.40% 1.80% 0.00% 1.79% NA
Aus  269 3.70% 1.10% 1.12% 94.05% NA
Indica I  595 26.90% 68.10% 0.17% 4.87% NA
Indica II  465 36.80% 62.80% 0.00% 0.43% NA
Indica III  913 28.70% 68.70% 0.00% 2.63% NA
Indica Intermediate  786 27.00% 65.00% 0.00% 8.02% NA
Temperate Japonica  767 98.60% 0.90% 0.00% 0.52% NA
Tropical Japonica  504 95.00% 1.80% 0.00% 3.17% NA
Japonica Intermediate  241 92.50% 4.60% 0.00% 2.90% NA
VI/Aromatic  96 34.40% 18.80% 1.04% 45.83% NA
Intermediate  90 45.60% 42.20% 1.11% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0206499072 A -> T LOC_Os02g12460.1 upstream_gene_variant ; 1335.0bp to feature; MODIFIER silent_mutation Average:35.666; most accessible tissue: Callus, score: 66.576 N N N N
vg0206499072 A -> T LOC_Os02g12450.1 downstream_gene_variant ; 3936.0bp to feature; MODIFIER silent_mutation Average:35.666; most accessible tissue: Callus, score: 66.576 N N N N
vg0206499072 A -> T LOC_Os02g12470.1 downstream_gene_variant ; 3078.0bp to feature; MODIFIER silent_mutation Average:35.666; most accessible tissue: Callus, score: 66.576 N N N N
vg0206499072 A -> T LOC_Os02g12460-LOC_Os02g12470 intergenic_region ; MODIFIER silent_mutation Average:35.666; most accessible tissue: Callus, score: 66.576 N N N N
vg0206499072 A -> DEL N N silent_mutation Average:35.666; most accessible tissue: Callus, score: 66.576 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0206499072 6.07E-08 3.28E-14 mr1714 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206499072 5.69E-07 5.69E-07 mr1714 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206499072 NA 1.00E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206499072 NA 9.06E-08 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206499072 NA 8.82E-06 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206499072 NA 6.16E-06 mr1706_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251