Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0206499072:

Variant ID: vg0206499072 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 6499072
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATGATTTGAAGATTGGAAAACCCTTGTTTTTATCTTCTAGTTTGAAGCTTCTATCTTTGCCTTTTCAATGGGCATAGTCTCAATCTTCGTCATAGTTCTA[A/T]
CCATCATGTATATCAACAGAGATCACTTTATAACCACTTTTAATTCTACCAATTTTTGACATATTTTGTGTTACTAAATTTTGATAGTGTTGGATATGTT

Reverse complement sequence

AACATATCCAACACTATCAAAATTTAGTAACACAAAATATGTCAAAAATTGGTAGAATTAAAAGTGGTTATAAAGTGATCTCTGTTGATATACATGATGG[T/A]
TAGAACTATGACGAAGATTGAGACTATGCCCATTGAAAAGGCAAAGATAGAAGCTTCAAACTAGAAGATAAAAACAAGGGTTTTCCAATCTTCAAATCAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.70%	40.60%	0.13%	9.56%	NA
All Indica	2759	29.20%	66.50%	0.04%	4.28%	NA
All Japonica	1512	96.40%	1.80%	0.00%	1.79%	NA
Aus	269	3.70%	1.10%	1.12%	94.05%	NA
Indica I	595	26.90%	68.10%	0.17%	4.87%	NA
Indica II	465	36.80%	62.80%	0.00%	0.43%	NA
Indica III	913	28.70%	68.70%	0.00%	2.63%	NA
Indica Intermediate	786	27.00%	65.00%	0.00%	8.02%	NA
Temperate Japonica	767	98.60%	0.90%	0.00%	0.52%	NA
Tropical Japonica	504	95.00%	1.80%	0.00%	3.17%	NA
Japonica Intermediate	241	92.50%	4.60%	0.00%	2.90%	NA
VI/Aromatic	96	34.40%	18.80%	1.04%	45.83%	NA
Intermediate	90	45.60%	42.20%	1.11%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0206499072	A -> T	LOC_Os02g12460.1	upstream_gene_variant ; 1335.0bp to feature; MODIFIER	silent_mutation	Average:35.666; most accessible tissue: Callus, score: 66.576	N	N	N	N
vg0206499072	A -> T	LOC_Os02g12450.1	downstream_gene_variant ; 3936.0bp to feature; MODIFIER	silent_mutation	Average:35.666; most accessible tissue: Callus, score: 66.576	N	N	N	N
vg0206499072	A -> T	LOC_Os02g12470.1	downstream_gene_variant ; 3078.0bp to feature; MODIFIER	silent_mutation	Average:35.666; most accessible tissue: Callus, score: 66.576	N	N	N	N
vg0206499072	A -> T	LOC_Os02g12460-LOC_Os02g12470	intergenic_region ; MODIFIER	silent_mutation	Average:35.666; most accessible tissue: Callus, score: 66.576	N	N	N	N
vg0206499072	A -> DEL	N	N	silent_mutation	Average:35.666; most accessible tissue: Callus, score: 66.576	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0206499072	6.07E-08	3.28E-14	mr1714	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206499072	5.69E-07	5.69E-07	mr1714	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206499072	NA	1.00E-06	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206499072	NA	9.06E-08	mr1170_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206499072	NA	8.82E-06	mr1170_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206499072	NA	6.16E-06	mr1706_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251