\
| Variant ID: vg0206499072 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 6499072 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATGATTTGAAGATTGGAAAACCCTTGTTTTTATCTTCTAGTTTGAAGCTTCTATCTTTGCCTTTTCAATGGGCATAGTCTCAATCTTCGTCATAGTTCTA[A/T]
CCATCATGTATATCAACAGAGATCACTTTATAACCACTTTTAATTCTACCAATTTTTGACATATTTTGTGTTACTAAATTTTGATAGTGTTGGATATGTT
AACATATCCAACACTATCAAAATTTAGTAACACAAAATATGTCAAAAATTGGTAGAATTAAAAGTGGTTATAAAGTGATCTCTGTTGATATACATGATGG[T/A]
TAGAACTATGACGAAGATTGAGACTATGCCCATTGAAAAGGCAAAGATAGAAGCTTCAAACTAGAAGATAAAAACAAGGGTTTTCCAATCTTCAAATCAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.70% | 40.60% | 0.13% | 9.56% | NA |
| All Indica | 2759 | 29.20% | 66.50% | 0.04% | 4.28% | NA |
| All Japonica | 1512 | 96.40% | 1.80% | 0.00% | 1.79% | NA |
| Aus | 269 | 3.70% | 1.10% | 1.12% | 94.05% | NA |
| Indica I | 595 | 26.90% | 68.10% | 0.17% | 4.87% | NA |
| Indica II | 465 | 36.80% | 62.80% | 0.00% | 0.43% | NA |
| Indica III | 913 | 28.70% | 68.70% | 0.00% | 2.63% | NA |
| Indica Intermediate | 786 | 27.00% | 65.00% | 0.00% | 8.02% | NA |
| Temperate Japonica | 767 | 98.60% | 0.90% | 0.00% | 0.52% | NA |
| Tropical Japonica | 504 | 95.00% | 1.80% | 0.00% | 3.17% | NA |
| Japonica Intermediate | 241 | 92.50% | 4.60% | 0.00% | 2.90% | NA |
| VI/Aromatic | 96 | 34.40% | 18.80% | 1.04% | 45.83% | NA |
| Intermediate | 90 | 45.60% | 42.20% | 1.11% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0206499072 | A -> T | LOC_Os02g12460.1 | upstream_gene_variant ; 1335.0bp to feature; MODIFIER | silent_mutation | Average:35.666; most accessible tissue: Callus, score: 66.576 | N | N | N | N |
| vg0206499072 | A -> T | LOC_Os02g12450.1 | downstream_gene_variant ; 3936.0bp to feature; MODIFIER | silent_mutation | Average:35.666; most accessible tissue: Callus, score: 66.576 | N | N | N | N |
| vg0206499072 | A -> T | LOC_Os02g12470.1 | downstream_gene_variant ; 3078.0bp to feature; MODIFIER | silent_mutation | Average:35.666; most accessible tissue: Callus, score: 66.576 | N | N | N | N |
| vg0206499072 | A -> T | LOC_Os02g12460-LOC_Os02g12470 | intergenic_region ; MODIFIER | silent_mutation | Average:35.666; most accessible tissue: Callus, score: 66.576 | N | N | N | N |
| vg0206499072 | A -> DEL | N | N | silent_mutation | Average:35.666; most accessible tissue: Callus, score: 66.576 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0206499072 | 6.07E-08 | 3.28E-14 | mr1714 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206499072 | 5.69E-07 | 5.69E-07 | mr1714 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206499072 | NA | 1.00E-06 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206499072 | NA | 9.06E-08 | mr1170_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206499072 | NA | 8.82E-06 | mr1170_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206499072 | NA | 6.16E-06 | mr1706_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |