Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0206383144:

Variant ID: vg0206383144 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 6383144
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, C: 0.04, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


TCTTGGGTGTGTGGTCTAAAAGAACAACGGCAGTAGCCCTGGTTATTCAGTTATGATGTTGTTATTGAAATTATTTTACGGATGTCTGTTCATTAGAATT[T/C]
AGTGGTAAAAAAAGATATTTTCATAGGCACCCTCTTACATTGCACATACAGTCAGCAAGAGCAATTGTGCCTATGGAAGCCAATTTCTCGTTGAGCGCAA

Reverse complement sequence

TTGCGCTCAACGAGAAATTGGCTTCCATAGGCACAATTGCTCTTGCTGACTGTATGTGCAATGTAAGAGGGTGCCTATGAAAATATCTTTTTTTACCACT[A/G]
AATTCTAATGAACAGACATCCGTAAAATAATTTCAATAACAACATCATAACTGAATAACCAGGGCTACTGCCGTTGTTCTTTTAGACCACACACCCAAGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.70% 14.90% 0.63% 45.77% NA
All Indica  2759 5.80% 19.70% 0.91% 73.65% NA
All Japonica  1512 96.80% 1.60% 0.07% 1.52% NA
Aus  269 46.10% 27.10% 0.74% 26.02% NA
Indica I  595 7.20% 6.40% 1.18% 85.21% NA
Indica II  465 3.00% 36.10% 1.08% 59.78% NA
Indica III  913 3.50% 21.70% 0.44% 74.37% NA
Indica Intermediate  786 8.90% 17.70% 1.15% 72.26% NA
Temperate Japonica  767 97.50% 0.30% 0.13% 2.09% NA
Tropical Japonica  504 96.40% 3.20% 0.00% 0.40% NA
Japonica Intermediate  241 95.40% 2.50% 0.00% 2.07% NA
VI/Aromatic  96 36.50% 55.20% 0.00% 8.33% NA
Intermediate  90 53.30% 11.10% 2.22% 33.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0206383144 T -> DEL N N silent_mutation Average:29.637; most accessible tissue: Minghui63 root, score: 75.155 N N N N
vg0206383144 T -> C LOC_Os02g12260.1 upstream_gene_variant ; 2621.0bp to feature; MODIFIER silent_mutation Average:29.637; most accessible tissue: Minghui63 root, score: 75.155 N N N N
vg0206383144 T -> C LOC_Os02g12250.1 downstream_gene_variant ; 217.0bp to feature; MODIFIER silent_mutation Average:29.637; most accessible tissue: Minghui63 root, score: 75.155 N N N N
vg0206383144 T -> C LOC_Os02g12270.1 downstream_gene_variant ; 4374.0bp to feature; MODIFIER silent_mutation Average:29.637; most accessible tissue: Minghui63 root, score: 75.155 N N N N
vg0206383144 T -> C LOC_Os02g12250-LOC_Os02g12260 intergenic_region ; MODIFIER silent_mutation Average:29.637; most accessible tissue: Minghui63 root, score: 75.155 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0206383144 NA 7.67E-22 mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206383144 NA 5.80E-44 mr1089 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206383144 NA 7.78E-41 mr1093 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206383144 NA 3.81E-50 mr1125 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206383144 NA 3.98E-33 mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206383144 NA 1.95E-43 mr1136 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206383144 NA 1.01E-11 mr1175 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206383144 NA 1.44E-39 mr1235 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206383144 NA 2.23E-32 mr1243 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206383144 NA 3.86E-25 mr1251 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206383144 NA 3.79E-19 mr1253 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206383144 NA 4.30E-18 mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206383144 NA 2.42E-31 mr1257 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206383144 NA 4.85E-25 mr1264 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206383144 NA 2.67E-09 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206383144 NA 4.38E-27 mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206383144 NA 2.34E-38 mr1435 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206383144 NA 1.32E-32 mr1448 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206383144 NA 9.43E-27 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206383144 NA 5.12E-24 mr1551 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206383144 NA 4.63E-08 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206383144 2.43E-06 4.77E-49 mr1591 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206383144 NA 4.62E-52 mr1599 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206383144 NA 1.07E-28 mr1638 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206383144 NA 5.81E-12 mr1657 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206383144 NA 1.51E-09 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206383144 NA 1.77E-16 mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206383144 NA 1.98E-10 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206383144 NA 1.65E-10 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206383144 NA 8.35E-43 mr1828 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206383144 NA 7.37E-24 mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206383144 4.85E-06 1.13E-44 mr1890 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206383144 NA 1.74E-40 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206383144 NA 9.10E-19 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206383144 NA 6.15E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206383144 NA 2.15E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206383144 NA 2.61E-33 mr1257_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206383144 NA 3.27E-26 mr1323_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206383144 NA 5.92E-13 mr1325_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206383144 NA 2.23E-13 mr1326_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206383144 NA 1.44E-09 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206383144 NA 5.37E-08 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206383144 NA 6.53E-12 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206383144 NA 7.48E-09 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206383144 NA 4.96E-11 mr1781_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206383144 NA 2.02E-14 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206383144 NA 2.61E-43 mr1944_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206383144 NA 6.86E-11 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251