\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0206377668:

Variant ID: vg0206377668 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 6377668
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGCGCCTCGCGCCCCCCGGCAAAACCTTCGCGTTGCTGTCGAAGAAGAACAGAGAAAGAGAGATTGACAAGTGGGCCCATGGACAAACTTGTCTTTAAC[T/C]
TAAGTTTCTCTCTCCGTTTTCATCGAAAATAATAAAATAATGGGAGGAGTGTCCAGTAGCTAATTACCACTTTTTTACCGTGTCCACGAGCAAATACACG

Reverse complement sequence

CGTGTATTTGCTCGTGGACACGGTAAAAAAGTGGTAATTAGCTACTGGACACTCCTCCCATTATTTTATTATTTTCGATGAAAACGGAGAGAGAAACTTA[A/G]
GTTAAAGACAAGTTTGTCCATGGGCCCACTTGTCAATCTCTCTTTCTCTGTTCTTCTTCGACAGCAACGCGAAGGTTTTGCCGGGGGGCGCGAGGCGCTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.70% 35.10% 3.07% 3.15% NA
All Indica  2759 87.80% 3.80% 3.52% 4.89% NA
All Japonica  1512 2.00% 96.30% 1.32% 0.40% NA
Aus  269 81.00% 11.90% 6.69% 0.37% NA
Indica I  595 83.50% 4.50% 5.71% 6.22% NA
Indica II  465 75.50% 5.80% 5.59% 13.12% NA
Indica III  913 95.70% 1.90% 1.64% 0.77% NA
Indica Intermediate  786 89.20% 4.20% 2.80% 3.82% NA
Temperate Japonica  767 1.40% 97.30% 0.52% 0.78% NA
Tropical Japonica  504 2.00% 95.60% 2.38% 0.00% NA
Japonica Intermediate  241 3.70% 94.60% 1.66% 0.00% NA
VI/Aromatic  96 68.80% 27.10% 2.08% 2.08% NA
Intermediate  90 41.10% 44.40% 8.89% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0206377668 T -> DEL N N silent_mutation Average:39.38; most accessible tissue: Zhenshan97 flower, score: 59.755 N N N N
vg0206377668 T -> C LOC_Os02g12250.1 upstream_gene_variant ; 4408.0bp to feature; MODIFIER silent_mutation Average:39.38; most accessible tissue: Zhenshan97 flower, score: 59.755 N N N N
vg0206377668 T -> C LOC_Os02g12230.1 downstream_gene_variant ; 1738.0bp to feature; MODIFIER silent_mutation Average:39.38; most accessible tissue: Zhenshan97 flower, score: 59.755 N N N N
vg0206377668 T -> C LOC_Os02g12240.1 downstream_gene_variant ; 639.0bp to feature; MODIFIER silent_mutation Average:39.38; most accessible tissue: Zhenshan97 flower, score: 59.755 N N N N
vg0206377668 T -> C LOC_Os02g12240-LOC_Os02g12250 intergenic_region ; MODIFIER silent_mutation Average:39.38; most accessible tissue: Zhenshan97 flower, score: 59.755 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0206377668 NA 5.79E-44 mr1136 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206377668 NA 2.03E-10 mr1175 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206377668 NA 9.92E-27 mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206377668 NA 3.37E-14 mr1361 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206377668 NA 1.12E-35 mr1448 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206377668 NA 8.09E-28 mr1638 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251