\
| Variant ID: vg0206377668 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 6377668 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GAGCGCCTCGCGCCCCCCGGCAAAACCTTCGCGTTGCTGTCGAAGAAGAACAGAGAAAGAGAGATTGACAAGTGGGCCCATGGACAAACTTGTCTTTAAC[T/C]
TAAGTTTCTCTCTCCGTTTTCATCGAAAATAATAAAATAATGGGAGGAGTGTCCAGTAGCTAATTACCACTTTTTTACCGTGTCCACGAGCAAATACACG
CGTGTATTTGCTCGTGGACACGGTAAAAAAGTGGTAATTAGCTACTGGACACTCCTCCCATTATTTTATTATTTTCGATGAAAACGGAGAGAGAAACTTA[A/G]
GTTAAAGACAAGTTTGTCCATGGGCCCACTTGTCAATCTCTCTTTCTCTGTTCTTCTTCGACAGCAACGCGAAGGTTTTGCCGGGGGGCGCGAGGCGCTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.70% | 35.10% | 3.07% | 3.15% | NA |
| All Indica | 2759 | 87.80% | 3.80% | 3.52% | 4.89% | NA |
| All Japonica | 1512 | 2.00% | 96.30% | 1.32% | 0.40% | NA |
| Aus | 269 | 81.00% | 11.90% | 6.69% | 0.37% | NA |
| Indica I | 595 | 83.50% | 4.50% | 5.71% | 6.22% | NA |
| Indica II | 465 | 75.50% | 5.80% | 5.59% | 13.12% | NA |
| Indica III | 913 | 95.70% | 1.90% | 1.64% | 0.77% | NA |
| Indica Intermediate | 786 | 89.20% | 4.20% | 2.80% | 3.82% | NA |
| Temperate Japonica | 767 | 1.40% | 97.30% | 0.52% | 0.78% | NA |
| Tropical Japonica | 504 | 2.00% | 95.60% | 2.38% | 0.00% | NA |
| Japonica Intermediate | 241 | 3.70% | 94.60% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 68.80% | 27.10% | 2.08% | 2.08% | NA |
| Intermediate | 90 | 41.10% | 44.40% | 8.89% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0206377668 | T -> DEL | N | N | silent_mutation | Average:39.38; most accessible tissue: Zhenshan97 flower, score: 59.755 | N | N | N | N |
| vg0206377668 | T -> C | LOC_Os02g12250.1 | upstream_gene_variant ; 4408.0bp to feature; MODIFIER | silent_mutation | Average:39.38; most accessible tissue: Zhenshan97 flower, score: 59.755 | N | N | N | N |
| vg0206377668 | T -> C | LOC_Os02g12230.1 | downstream_gene_variant ; 1738.0bp to feature; MODIFIER | silent_mutation | Average:39.38; most accessible tissue: Zhenshan97 flower, score: 59.755 | N | N | N | N |
| vg0206377668 | T -> C | LOC_Os02g12240.1 | downstream_gene_variant ; 639.0bp to feature; MODIFIER | silent_mutation | Average:39.38; most accessible tissue: Zhenshan97 flower, score: 59.755 | N | N | N | N |
| vg0206377668 | T -> C | LOC_Os02g12240-LOC_Os02g12250 | intergenic_region ; MODIFIER | silent_mutation | Average:39.38; most accessible tissue: Zhenshan97 flower, score: 59.755 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0206377668 | NA | 5.79E-44 | mr1136 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206377668 | NA | 2.03E-10 | mr1175 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206377668 | NA | 9.92E-27 | mr1309 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206377668 | NA | 3.37E-14 | mr1361 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206377668 | NA | 1.12E-35 | mr1448 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206377668 | NA | 8.09E-28 | mr1638 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |