\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0206372366:

Variant ID: vg0206372366 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 6372366
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAACGGCGGTGGTGACAGAACAGACGTCAAGGAAGGCGGTGGCTGCAGCGACAAGAGGAGAACGGCACGTTGCCAGGCTCTCGAGCTCACCCCTCATCAG[T/C]
GATCCGTTCTTCGCTCAACCTCGCTGTTGTCGCAGGCTCCAAACCTAGATGACGGTACAAATCCAGTGGAGCTCTTGCTGCTCGTCACCTCTCAGGTCGG

Reverse complement sequence

CCGACCTGAGAGGTGACGAGCAGCAAGAGCTCCACTGGATTTGTACCGTCATCTAGGTTTGGAGCCTGCGACAACAGCGAGGTTGAGCGAAGAACGGATC[A/G]
CTGATGAGGGGTGAGCTCGAGAGCCTGGCAACGTGCCGTTCTCCTCTTGTCGCTGCAGCCACCGCCTTCCTTGACGTCTGTTCTGTCACCACCGCCGTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.60% 38.60% 0.51% 3.36% NA
All Indica  2759 88.30% 5.40% 0.80% 5.51% NA
All Japonica  1512 3.00% 96.90% 0.00% 0.07% NA
Aus  269 51.70% 47.20% 0.00% 1.12% NA
Indica I  595 89.90% 6.60% 0.84% 2.69% NA
Indica II  465 90.50% 1.90% 0.86% 6.67% NA
Indica III  913 89.40% 3.10% 0.44% 7.12% NA
Indica Intermediate  786 84.50% 9.30% 1.15% 5.09% NA
Temperate Japonica  767 2.20% 97.70% 0.00% 0.13% NA
Tropical Japonica  504 3.60% 96.40% 0.00% 0.00% NA
Japonica Intermediate  241 4.60% 95.40% 0.00% 0.00% NA
VI/Aromatic  96 62.50% 36.50% 0.00% 1.04% NA
Intermediate  90 44.40% 51.10% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0206372366 T -> DEL N N silent_mutation Average:19.524; most accessible tissue: Callus, score: 51.898 N N N N
vg0206372366 T -> C LOC_Os02g12220.1 upstream_gene_variant ; 2832.0bp to feature; MODIFIER silent_mutation Average:19.524; most accessible tissue: Callus, score: 51.898 N N N N
vg0206372366 T -> C LOC_Os02g12230.1 upstream_gene_variant ; 2263.0bp to feature; MODIFIER silent_mutation Average:19.524; most accessible tissue: Callus, score: 51.898 N N N N
vg0206372366 T -> C LOC_Os02g12240.1 upstream_gene_variant ; 4151.0bp to feature; MODIFIER silent_mutation Average:19.524; most accessible tissue: Callus, score: 51.898 N N N N
vg0206372366 T -> C LOC_Os02g12220-LOC_Os02g12230 intergenic_region ; MODIFIER silent_mutation Average:19.524; most accessible tissue: Callus, score: 51.898 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0206372366 NA 9.74E-42 mr1089 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366 2.18E-06 NA mr1112 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366 NA 7.53E-11 mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366 NA 4.81E-10 mr1175 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366 NA 1.03E-16 mr1199 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366 NA 1.67E-39 mr1235 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366 NA 2.75E-35 mr1243 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366 NA 2.91E-18 mr1253 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366 NA 8.66E-18 mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366 NA 9.86E-32 mr1257 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366 NA 1.05E-24 mr1264 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366 NA 3.00E-06 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366 NA 9.25E-25 mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366 NA 2.94E-25 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366 NA 1.61E-07 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366 NA 1.50E-09 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366 NA 7.56E-44 mr1591 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366 NA 1.07E-15 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366 NA 5.67E-51 mr1599 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366 NA 4.03E-11 mr1657 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366 NA 1.08E-09 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366 NA 1.31E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366 NA 1.13E-10 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366 NA 2.33E-38 mr1828 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366 NA 1.28E-40 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366 NA 3.81E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251