Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0206372366:

Variant ID: vg0206372366 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 6372366
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAACGGCGGTGGTGACAGAACAGACGTCAAGGAAGGCGGTGGCTGCAGCGACAAGAGGAGAACGGCACGTTGCCAGGCTCTCGAGCTCACCCCTCATCAG[T/C]
GATCCGTTCTTCGCTCAACCTCGCTGTTGTCGCAGGCTCCAAACCTAGATGACGGTACAAATCCAGTGGAGCTCTTGCTGCTCGTCACCTCTCAGGTCGG

Reverse complement sequence

CCGACCTGAGAGGTGACGAGCAGCAAGAGCTCCACTGGATTTGTACCGTCATCTAGGTTTGGAGCCTGCGACAACAGCGAGGTTGAGCGAAGAACGGATC[A/G]
CTGATGAGGGGTGAGCTCGAGAGCCTGGCAACGTGCCGTTCTCCTCTTGTCGCTGCAGCCACCGCCTTCCTTGACGTCTGTTCTGTCACCACCGCCGTTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.60%	38.60%	0.51%	3.36%	NA
All Indica	2759	88.30%	5.40%	0.80%	5.51%	NA
All Japonica	1512	3.00%	96.90%	0.00%	0.07%	NA
Aus	269	51.70%	47.20%	0.00%	1.12%	NA
Indica I	595	89.90%	6.60%	0.84%	2.69%	NA
Indica II	465	90.50%	1.90%	0.86%	6.67%	NA
Indica III	913	89.40%	3.10%	0.44%	7.12%	NA
Indica Intermediate	786	84.50%	9.30%	1.15%	5.09%	NA
Temperate Japonica	767	2.20%	97.70%	0.00%	0.13%	NA
Tropical Japonica	504	3.60%	96.40%	0.00%	0.00%	NA
Japonica Intermediate	241	4.60%	95.40%	0.00%	0.00%	NA
VI/Aromatic	96	62.50%	36.50%	0.00%	1.04%	NA
Intermediate	90	44.40%	51.10%	2.22%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0206372366	T -> DEL	N	N	silent_mutation	Average:19.524; most accessible tissue: Callus, score: 51.898	N	N	N	N
vg0206372366	T -> C	LOC_Os02g12220.1	upstream_gene_variant ; 2832.0bp to feature; MODIFIER	silent_mutation	Average:19.524; most accessible tissue: Callus, score: 51.898	N	N	N	N
vg0206372366	T -> C	LOC_Os02g12230.1	upstream_gene_variant ; 2263.0bp to feature; MODIFIER	silent_mutation	Average:19.524; most accessible tissue: Callus, score: 51.898	N	N	N	N
vg0206372366	T -> C	LOC_Os02g12240.1	upstream_gene_variant ; 4151.0bp to feature; MODIFIER	silent_mutation	Average:19.524; most accessible tissue: Callus, score: 51.898	N	N	N	N
vg0206372366	T -> C	LOC_Os02g12220-LOC_Os02g12230	intergenic_region ; MODIFIER	silent_mutation	Average:19.524; most accessible tissue: Callus, score: 51.898	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0206372366	NA	9.74E-42	mr1089	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366	2.18E-06	NA	mr1112	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366	NA	7.53E-11	mr1138	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366	NA	4.81E-10	mr1175	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366	NA	1.03E-16	mr1199	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366	NA	1.67E-39	mr1235	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366	NA	2.75E-35	mr1243	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366	NA	2.91E-18	mr1253	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366	NA	8.66E-18	mr1255	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366	NA	9.86E-32	mr1257	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366	NA	1.05E-24	mr1264	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366	NA	3.00E-06	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366	NA	9.25E-25	mr1411	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366	NA	2.94E-25	mr1537	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366	NA	1.61E-07	mr1559	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366	NA	1.50E-09	mr1578	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366	NA	7.56E-44	mr1591	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366	NA	1.07E-15	mr1592	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366	NA	5.67E-51	mr1599	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366	NA	4.03E-11	mr1657	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366	NA	1.08E-09	mr1746	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366	NA	1.31E-06	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366	NA	1.13E-10	mr1819	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366	NA	2.33E-38	mr1828	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366	NA	1.28E-40	mr1890	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206372366	NA	3.81E-07	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251