| Variant ID: vg0206372366 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 6372366 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AAACGGCGGTGGTGACAGAACAGACGTCAAGGAAGGCGGTGGCTGCAGCGACAAGAGGAGAACGGCACGTTGCCAGGCTCTCGAGCTCACCCCTCATCAG[T/C]
GATCCGTTCTTCGCTCAACCTCGCTGTTGTCGCAGGCTCCAAACCTAGATGACGGTACAAATCCAGTGGAGCTCTTGCTGCTCGTCACCTCTCAGGTCGG
CCGACCTGAGAGGTGACGAGCAGCAAGAGCTCCACTGGATTTGTACCGTCATCTAGGTTTGGAGCCTGCGACAACAGCGAGGTTGAGCGAAGAACGGATC[A/G]
CTGATGAGGGGTGAGCTCGAGAGCCTGGCAACGTGCCGTTCTCCTCTTGTCGCTGCAGCCACCGCCTTCCTTGACGTCTGTTCTGTCACCACCGCCGTTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.60% | 38.60% | 0.51% | 3.36% | NA |
| All Indica | 2759 | 88.30% | 5.40% | 0.80% | 5.51% | NA |
| All Japonica | 1512 | 3.00% | 96.90% | 0.00% | 0.07% | NA |
| Aus | 269 | 51.70% | 47.20% | 0.00% | 1.12% | NA |
| Indica I | 595 | 89.90% | 6.60% | 0.84% | 2.69% | NA |
| Indica II | 465 | 90.50% | 1.90% | 0.86% | 6.67% | NA |
| Indica III | 913 | 89.40% | 3.10% | 0.44% | 7.12% | NA |
| Indica Intermediate | 786 | 84.50% | 9.30% | 1.15% | 5.09% | NA |
| Temperate Japonica | 767 | 2.20% | 97.70% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 3.60% | 96.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 4.60% | 95.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 62.50% | 36.50% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 44.40% | 51.10% | 2.22% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0206372366 | T -> DEL | N | N | silent_mutation | Average:19.524; most accessible tissue: Callus, score: 51.898 | N | N | N | N |
| vg0206372366 | T -> C | LOC_Os02g12220.1 | upstream_gene_variant ; 2832.0bp to feature; MODIFIER | silent_mutation | Average:19.524; most accessible tissue: Callus, score: 51.898 | N | N | N | N |
| vg0206372366 | T -> C | LOC_Os02g12230.1 | upstream_gene_variant ; 2263.0bp to feature; MODIFIER | silent_mutation | Average:19.524; most accessible tissue: Callus, score: 51.898 | N | N | N | N |
| vg0206372366 | T -> C | LOC_Os02g12240.1 | upstream_gene_variant ; 4151.0bp to feature; MODIFIER | silent_mutation | Average:19.524; most accessible tissue: Callus, score: 51.898 | N | N | N | N |
| vg0206372366 | T -> C | LOC_Os02g12220-LOC_Os02g12230 | intergenic_region ; MODIFIER | silent_mutation | Average:19.524; most accessible tissue: Callus, score: 51.898 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0206372366 | NA | 9.74E-42 | mr1089 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206372366 | 2.18E-06 | NA | mr1112 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206372366 | NA | 7.53E-11 | mr1138 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206372366 | NA | 4.81E-10 | mr1175 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206372366 | NA | 1.03E-16 | mr1199 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206372366 | NA | 1.67E-39 | mr1235 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206372366 | NA | 2.75E-35 | mr1243 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206372366 | NA | 2.91E-18 | mr1253 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206372366 | NA | 8.66E-18 | mr1255 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206372366 | NA | 9.86E-32 | mr1257 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/