\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0206334099:

Variant ID: vg0206334099 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 6334099
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


GATTAGATATACTTGCATGTTGATTTGTAGAATTAATTAAATAAATCATAGATGATGTTGTATGCTTGCATGAGGTAAATATGTAATTATTGCTAGTCGG[C/T]
GATGATGTGGCATGGTTGTATGTTGAGTTTTAGGAGTTAGCTACTAGGCATCAACTTTATAGTAAAATAGGATTGGAGTGAGCCAATGGTTGTCATATTG

Reverse complement sequence

CAATATGACAACCATTGGCTCACTCCAATCCTATTTTACTATAAAGTTGATGCCTAGTAGCTAACTCCTAAAACTCAACATACAACCATGCCACATCATC[G/A]
CCGACTAGCAATAATTACATATTTACCTCATGCAAGCATACAACATCATCTATGATTTATTTAATTAATTCTACAAATCAACATGCAAGTATATCTAATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.90% 0.40% 0.61% 65.04% NA
All Indica  2759 2.60% 0.70% 1.01% 95.76% NA
All Japonica  1512 96.40% 0.00% 0.00% 3.57% NA
Aus  269 1.90% 0.40% 0.37% 97.40% NA
Indica I  595 3.90% 0.00% 0.34% 95.80% NA
Indica II  465 2.40% 1.10% 1.29% 95.27% NA
Indica III  913 1.60% 1.00% 1.20% 96.17% NA
Indica Intermediate  786 2.80% 0.50% 1.15% 95.55% NA
Temperate Japonica  767 97.50% 0.00% 0.00% 2.48% NA
Tropical Japonica  504 95.80% 0.00% 0.00% 4.17% NA
Japonica Intermediate  241 94.20% 0.00% 0.00% 5.81% NA
VI/Aromatic  96 31.20% 1.00% 0.00% 67.71% NA
Intermediate  90 43.30% 0.00% 0.00% 56.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0206334099 C -> T LOC_Os02g12180-LOC_Os02g12200 intergenic_region ; MODIFIER silent_mutation Average:8.481; most accessible tissue: Callus, score: 26.902 N N N N
vg0206334099 C -> DEL N N silent_mutation Average:8.481; most accessible tissue: Callus, score: 26.902 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0206334099 NA 3.66E-07 mr1726 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206334099 NA 2.26E-06 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206334099 NA 1.24E-06 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206334099 NA 2.12E-10 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206334099 NA 5.03E-06 mr1114_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206334099 NA 3.28E-06 mr1204_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206334099 NA 1.79E-07 mr1304_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206334099 NA 5.77E-07 mr1383_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206334099 NA 4.21E-06 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206334099 NA 4.44E-06 mr1696_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206334099 NA 4.95E-07 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206334099 2.39E-06 NA mr1846_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206334099 NA 1.07E-10 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251