Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0206309823:

Variant ID: vg0206309823 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 6309823
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCGCCGCTAAGCGTGACCGACCGCCACTAGACCAACAAAGAGACACAGACGAGATCGCGCCATACGGAAGAACCGCCGCCGCCATCCGTCGGGACTCAAA[A/G]
GAGCCAAGACTGGGCTTTCGACCAGCAATCACCCTTGAGGAGAGAGACAGCACAACAACGCCTCAGGAGGGGGAATAACCATCGTTGTCGGTCTGGCCAA

Reverse complement sequence

TTGGCCAGACCGACAACGATGGTTATTCCCCCTCCTGAGGCGTTGTTGTGCTGTCTCTCTCCTCAAGGGTGATTGCTGGTCGAAAGCCCAGTCTTGGCTC[T/C]
TTTGAGTCCCGACGGATGGCGGCGGCGGTTCTTCCGTATGGCGCGATCTCGTCTGTGTCTCTTTGTTGGTCTAGTGGCGGTCGGTCACGCTTAGCGGCGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.10%	32.80%	0.32%	3.83%	NA
All Indica	2759	96.00%	1.00%	0.22%	2.79%	NA
All Japonica	1512	3.80%	95.80%	0.33%	0.13%	NA
Aus	269	73.60%	1.50%	1.12%	23.79%	NA
Indica I	595	99.20%	0.50%	0.34%	0.00%	NA
Indica II	465	90.10%	1.30%	0.65%	7.96%	NA
Indica III	913	97.40%	0.50%	0.11%	1.97%	NA
Indica Intermediate	786	95.50%	1.70%	0.00%	2.80%	NA
Temperate Japonica	767	3.10%	96.20%	0.65%	0.00%	NA
Tropical Japonica	504	4.20%	95.80%	0.00%	0.00%	NA
Japonica Intermediate	241	5.00%	94.20%	0.00%	0.83%	NA
VI/Aromatic	96	30.20%	33.30%	1.04%	35.42%	NA
Intermediate	90	53.30%	42.20%	0.00%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0206309823	A -> G	LOC_Os02g12130.1	upstream_gene_variant ; 1388.0bp to feature; MODIFIER	silent_mutation	Average:72.975; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0206309823	A -> G	LOC_Os02g12120.1	intron_variant ; MODIFIER	silent_mutation	Average:72.975; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0206309823	A -> DEL	N	N	silent_mutation	Average:72.975; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0206309823	NA	5.13E-10	mr1128	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206309823	NA	4.01E-08	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206309823	NA	4.92E-15	mr1218	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206309823	1.37E-06	NA	mr1504	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206309823	NA	3.31E-10	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206309823	NA	2.06E-06	mr1850	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206309823	NA	1.13E-09	mr1379_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206309823	NA	2.67E-06	mr1559_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206309823	NA	1.09E-22	mr1708_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206309823	NA	4.93E-08	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251