\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0206301209:

Variant ID: vg0206301209 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 6301209
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCTACTCTCCCAGCTCCCTCAAAGTGGACGTACTCGACAGTGAAGTCCTCGTATGTTGGAGTCGAACCATCGTCCACCGCCTTGTCCCATGCCCACCCTC[G/A]
CCCTTCGTCGAACACTACGTCGCACGCCGTGCGCACACGCTGTGTCTCCGGGTCGAGAATGCGGTAGGCCTTCGAGCCCTCCGTGTAGCTGATGAACACC

Reverse complement sequence

GGTGTTCATCAGCTACACGGAGGGCTCGAAGGCCTACCGCATTCTCGACCCGGAGACACAGCGTGTGCGCACGGCGTGCGACGTAGTGTTCGACGAAGGG[C/T]
GAGGGTGGGCATGGGACAAGGCGGTGGACGATGGTTCGACTCCAACATACGAGGACTTCACTGTCGAGTACGTCCACTTTGAGGGAGCTGGGAGAGTAGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.60% 3.30% 0.83% 3.28% NA
All Indica  2759 97.10% 0.30% 0.22% 2.39% NA
All Japonica  1512 89.60% 8.40% 1.85% 0.13% NA
Aus  269 78.80% 0.00% 1.49% 19.70% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 92.70% 0.20% 0.22% 6.88% NA
Indica III  913 97.90% 0.20% 0.22% 1.64% NA
Indica Intermediate  786 96.70% 0.60% 0.25% 2.42% NA
Temperate Japonica  767 97.50% 0.90% 1.56% 0.00% NA
Tropical Japonica  504 82.50% 15.50% 1.98% 0.00% NA
Japonica Intermediate  241 79.30% 17.40% 2.49% 0.83% NA
VI/Aromatic  96 52.10% 15.60% 1.04% 31.25% NA
Intermediate  90 90.00% 5.60% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0206301209 G -> A LOC_Os02g12120.1 stop_gained ; p.Arg1605*; HIGH stop_gained Average:76.066; most accessible tissue: Minghui63 young leaf, score: 85.236 N N N N
vg0206301209 G -> DEL LOC_Os02g12120.1 N frameshift_variant Average:76.066; most accessible tissue: Minghui63 young leaf, score: 85.236 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0206301209 G A 0.0 0.0 -0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0206301209 2.12E-06 2.12E-06 mr1159_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206301209 4.72E-06 4.72E-06 mr1286_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206301209 2.00E-06 2.00E-06 mr1312_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206301209 5.20E-06 5.19E-06 mr1373_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206301209 9.64E-06 9.63E-06 mr1374_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206301209 NA 2.74E-06 mr1397_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206301209 NA 3.08E-06 mr1544_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206301209 5.50E-06 5.50E-06 mr1634_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206301209 8.61E-06 8.60E-06 mr1663_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206301209 NA 8.88E-07 mr1665_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206301209 NA 7.60E-06 mr1683_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206301209 3.42E-06 3.42E-06 mr1687_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206301209 NA 3.19E-07 mr1738_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206301209 NA 8.88E-06 mr1764_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206301209 1.24E-06 1.24E-06 mr1832_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206301209 NA 2.40E-06 mr1833_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206301209 9.42E-06 9.42E-06 mr1843_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206301209 4.50E-06 4.50E-06 mr1847_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251