\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0206301171:

Variant ID: vg0206301171 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 6301171
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGGGGACTGGGGTAGACACGCTCGGTGAAGAAGAGCTGCCTACTCTCCCAGCTCCCTCAAAGTGGACGTACTCGACAGTGAAGTCCTCGTATGTTGGAGT[C/T]
GAACCATCGTCCACCGCCTTGTCCCATGCCCACCCTCGCCCTTCGTCGAACACTACGTCGCACGCCGTGCGCACACGCTGTGTCTCCGGGTCGAGAATGC

Reverse complement sequence

GCATTCTCGACCCGGAGACACAGCGTGTGCGCACGGCGTGCGACGTAGTGTTCGACGAAGGGCGAGGGTGGGCATGGGACAAGGCGGTGGACGATGGTTC[G/A]
ACTCCAACATACGAGGACTTCACTGTCGAGTACGTCCACTTTGAGGGAGCTGGGAGAGTAGGCAGCTCTTCTTCACCGAGCGTGTCTACCCCAGTCCCCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.20% 36.60% 0.15% 4.08% NA
All Indica  2759 94.40% 2.50% 0.00% 3.08% NA
All Japonica  1512 3.50% 96.00% 0.33% 0.13% NA
Aus  269 29.00% 46.80% 0.37% 23.79% NA
Indica I  595 99.20% 0.50% 0.00% 0.34% NA
Indica II  465 90.30% 1.50% 0.00% 8.17% NA
Indica III  913 95.40% 2.40% 0.00% 2.19% NA
Indica Intermediate  786 92.00% 4.80% 0.00% 3.18% NA
Temperate Japonica  767 3.30% 96.10% 0.65% 0.00% NA
Tropical Japonica  504 3.60% 96.40% 0.00% 0.00% NA
Japonica Intermediate  241 4.10% 95.00% 0.00% 0.83% NA
VI/Aromatic  96 20.80% 41.70% 0.00% 37.50% NA
Intermediate  90 45.60% 46.70% 1.11% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0206301171 C -> T LOC_Os02g12120.1 synonymous_variant ; p.Ser1617Ser; LOW synonymous_codon Average:73.185; most accessible tissue: Minghui63 flag leaf, score: 84.608 N N N N
vg0206301171 C -> DEL LOC_Os02g12120.1 N frameshift_variant Average:73.185; most accessible tissue: Minghui63 flag leaf, score: 84.608 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0206301171 C T -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0206301171 NA 4.90E-13 mr1175 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206301171 NA 2.22E-15 mr1199 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206301171 NA 1.55E-24 mr1251 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206301171 NA 1.54E-18 mr1253 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206301171 NA 2.92E-17 mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206301171 NA 3.11E-24 mr1264 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206301171 NA 7.11E-09 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206301171 NA 6.07E-10 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206301171 NA 6.78E-06 mr1504 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206301171 NA 2.92E-25 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206301171 NA 1.81E-07 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206301171 NA 9.21E-45 mr1591 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206301171 NA 1.37E-11 mr1657 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206301171 NA 2.17E-09 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206301171 NA 4.20E-35 mr1828 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206301171 NA 1.27E-40 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206301171 NA 1.58E-06 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251