Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0206262084:

Variant ID: vg0206262084 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 6262084
Reference Allele: G	Alternative Allele: T
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, T: 0.05, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

GCTCATTTTACTCTCTTAACTATTGAAAACGACTCACCTTACTCCATAACTGTATTTCTCTTTTAGTTTCTATTTTACACTAAAATTTGATAAGATCATA[G/T]
ATGCATTATAAATTACCTCTTCATAATTTTTAGATTTTTTTATCACTGTTTACATGGGTTGAAAGCACTATGACTGATTTAAACATCGAGATTTTAAACT

Reverse complement sequence

AGTTTAAAATCTCGATGTTTAAATCAGTCATAGTGCTTTCAACCCATGTAAACAGTGATAAAAAAATCTAAAAATTATGAAGAGGTAATTTATAATGCAT[C/A]
TATGATCTTATCAAATTTTAGTGTAAAATAGAAACTAAAAGAGAAATACAGTTATGGAGTAAGGTGAGTCGTTTTCAATAGTTAAGAGAGTAAAATGAGC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.80%	38.90%	0.28%	0.02%	NA
All Indica	2759	88.30%	11.20%	0.43%	0.04%	NA
All Japonica	1512	3.50%	96.50%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.00%	0.80%	0.17%	0.00%	NA
Indica II	465	74.40%	24.30%	1.08%	0.22%	NA
Indica III	913	86.30%	13.40%	0.33%	0.00%	NA
Indica Intermediate	786	90.70%	8.90%	0.38%	0.00%	NA
Temperate Japonica	767	2.30%	97.70%	0.00%	0.00%	NA
Tropical Japonica	504	4.20%	95.80%	0.00%	0.00%	NA
Japonica Intermediate	241	5.80%	94.20%	0.00%	0.00%	NA
VI/Aromatic	96	66.70%	32.30%	1.04%	0.00%	NA
Intermediate	90	57.80%	42.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0206262084	G -> T	LOC_Os02g12060.1	upstream_gene_variant ; 461.0bp to feature; MODIFIER	silent_mutation	Average:31.268; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0206262084	G -> T	LOC_Os02g12070.1	upstream_gene_variant ; 3975.0bp to feature; MODIFIER	silent_mutation	Average:31.268; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0206262084	G -> T	LOC_Os02g12050.1	downstream_gene_variant ; 2025.0bp to feature; MODIFIER	silent_mutation	Average:31.268; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0206262084	G -> T	LOC_Os02g12060-LOC_Os02g12070	intergenic_region ; MODIFIER	silent_mutation	Average:31.268; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg0206262084	G -> DEL	N	N	silent_mutation	Average:31.268; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0206262084	NA	8.74E-13	mr1170	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206262084	NA	1.41E-08	mr1301	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206262084	NA	7.67E-10	mr1410	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206262084	NA	1.19E-07	mr1030_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206262084	NA	2.89E-09	mr1170_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206262084	NA	4.07E-11	mr1216_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206262084	NA	1.35E-25	mr1233_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206262084	NA	6.35E-06	mr1233_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206262084	NA	2.15E-40	mr1243_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206262084	NA	1.06E-16	mr1342_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206262084	NA	5.13E-09	mr1379_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206262084	NA	1.01E-62	mr1402_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206262084	NA	1.02E-06	mr1402_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206262084	NA	4.12E-08	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206262084	5.61E-06	5.61E-06	mr1424_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206262084	NA	7.12E-07	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206262084	NA	3.65E-26	mr1617_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206262084	NA	9.56E-19	mr1637_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206262084	NA	8.51E-06	mr1743_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206262084	NA	3.34E-06	mr1754_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206262084	NA	3.16E-34	mr1780_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206262084	NA	5.12E-08	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206262084	NA	1.49E-06	mr1878_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206262084	NA	2.08E-06	mr1915_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206262084	NA	1.59E-25	mr1949_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251