Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0206260893:

Variant ID: vg0206260893 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 6260893
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, G: 0.02, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:

TTCTAGTATTGTCCACATTCATATATATGCTAATAATTTAGACATATATGTGTGTCTAGATTCATTAACATCTATATGAATATGGACAATGCTAGAAAGT[C/T]
TTATAACCTGAAACGGTCCGTAGGTAGTATTAGTGTATTACCACAGCTAATGACCAGCTTCTAGTATAAAGTTTATTACTGCAAGCGGTGAATTAATATA

Reverse complement sequence

TATATTAATTCACCGCTTGCAGTAATAAACTTTATACTAGAAGCTGGTCATTAGCTGTGGTAATACACTAATACTACCTACGGACCGTTTCAGGTTATAA[G/A]
ACTTTCTAGCATTGTCCATATTCATATAGATGTTAATGAATCTAGACACACATATATGTCTAAATTATTAGCATATATATGAATGTGGACAATACTAGAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	33.40%	6.40%	0.70%	59.50%	NA
All Indica	2759	1.90%	10.80%	1.09%	86.26%	NA
All Japonica	1512	96.30%	0.20%	0.07%	3.44%	NA
Aus	269	0.40%	0.00%	0.37%	99.26%	NA
Indica I	595	2.20%	0.30%	1.01%	96.47%	NA
Indica II	465	1.70%	24.10%	0.43%	73.76%	NA
Indica III	913	1.20%	13.30%	1.20%	84.34%	NA
Indica Intermediate	786	2.50%	7.90%	1.40%	88.17%	NA
Temperate Japonica	767	97.40%	0.30%	0.13%	2.22%	NA
Tropical Japonica	504	95.60%	0.20%	0.00%	4.17%	NA
Japonica Intermediate	241	94.20%	0.00%	0.00%	5.81%	NA
VI/Aromatic	96	31.20%	0.00%	0.00%	68.75%	NA
Intermediate	90	44.40%	2.20%	1.11%	52.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0206260893	C -> T	LOC_Os02g12040.1	upstream_gene_variant ; 4520.0bp to feature; MODIFIER	silent_mutation	Average:41.159; most accessible tissue: Zhenshan97 root, score: 68.289	N	N	N	N
vg0206260893	C -> T	LOC_Os02g12050.1	downstream_gene_variant ; 834.0bp to feature; MODIFIER	silent_mutation	Average:41.159; most accessible tissue: Zhenshan97 root, score: 68.289	N	N	N	N
vg0206260893	C -> T	LOC_Os02g12060.1	downstream_gene_variant ; 178.0bp to feature; MODIFIER	silent_mutation	Average:41.159; most accessible tissue: Zhenshan97 root, score: 68.289	N	N	N	N
vg0206260893	C -> T	LOC_Os02g12050-LOC_Os02g12060	intergenic_region ; MODIFIER	silent_mutation	Average:41.159; most accessible tissue: Zhenshan97 root, score: 68.289	N	N	N	N
vg0206260893	C -> DEL	N	N	silent_mutation	Average:41.159; most accessible tissue: Zhenshan97 root, score: 68.289	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0206260893	NA	1.33E-09	mr1301	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206260893	NA	1.09E-10	mr1410	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206260893	1.06E-07	NA	mr1170_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206260893	3.19E-07	9.14E-07	mr1170_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206260893	NA	4.80E-06	mr1233_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206260893	8.61E-06	8.61E-06	mr1424_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206260893	NA	2.46E-06	mr1609_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251