\
| Variant ID: vg0206260893 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 6260893 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, G: 0.02, others allele: 0.00, population size: 89. )
TTCTAGTATTGTCCACATTCATATATATGCTAATAATTTAGACATATATGTGTGTCTAGATTCATTAACATCTATATGAATATGGACAATGCTAGAAAGT[C/T]
TTATAACCTGAAACGGTCCGTAGGTAGTATTAGTGTATTACCACAGCTAATGACCAGCTTCTAGTATAAAGTTTATTACTGCAAGCGGTGAATTAATATA
TATATTAATTCACCGCTTGCAGTAATAAACTTTATACTAGAAGCTGGTCATTAGCTGTGGTAATACACTAATACTACCTACGGACCGTTTCAGGTTATAA[G/A]
ACTTTCTAGCATTGTCCATATTCATATAGATGTTAATGAATCTAGACACACATATATGTCTAAATTATTAGCATATATATGAATGTGGACAATACTAGAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 33.40% | 6.40% | 0.70% | 59.50% | NA |
| All Indica | 2759 | 1.90% | 10.80% | 1.09% | 86.26% | NA |
| All Japonica | 1512 | 96.30% | 0.20% | 0.07% | 3.44% | NA |
| Aus | 269 | 0.40% | 0.00% | 0.37% | 99.26% | NA |
| Indica I | 595 | 2.20% | 0.30% | 1.01% | 96.47% | NA |
| Indica II | 465 | 1.70% | 24.10% | 0.43% | 73.76% | NA |
| Indica III | 913 | 1.20% | 13.30% | 1.20% | 84.34% | NA |
| Indica Intermediate | 786 | 2.50% | 7.90% | 1.40% | 88.17% | NA |
| Temperate Japonica | 767 | 97.40% | 0.30% | 0.13% | 2.22% | NA |
| Tropical Japonica | 504 | 95.60% | 0.20% | 0.00% | 4.17% | NA |
| Japonica Intermediate | 241 | 94.20% | 0.00% | 0.00% | 5.81% | NA |
| VI/Aromatic | 96 | 31.20% | 0.00% | 0.00% | 68.75% | NA |
| Intermediate | 90 | 44.40% | 2.20% | 1.11% | 52.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0206260893 | C -> T | LOC_Os02g12040.1 | upstream_gene_variant ; 4520.0bp to feature; MODIFIER | silent_mutation | Average:41.159; most accessible tissue: Zhenshan97 root, score: 68.289 | N | N | N | N |
| vg0206260893 | C -> T | LOC_Os02g12050.1 | downstream_gene_variant ; 834.0bp to feature; MODIFIER | silent_mutation | Average:41.159; most accessible tissue: Zhenshan97 root, score: 68.289 | N | N | N | N |
| vg0206260893 | C -> T | LOC_Os02g12060.1 | downstream_gene_variant ; 178.0bp to feature; MODIFIER | silent_mutation | Average:41.159; most accessible tissue: Zhenshan97 root, score: 68.289 | N | N | N | N |
| vg0206260893 | C -> T | LOC_Os02g12050-LOC_Os02g12060 | intergenic_region ; MODIFIER | silent_mutation | Average:41.159; most accessible tissue: Zhenshan97 root, score: 68.289 | N | N | N | N |
| vg0206260893 | C -> DEL | N | N | silent_mutation | Average:41.159; most accessible tissue: Zhenshan97 root, score: 68.289 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0206260893 | NA | 1.33E-09 | mr1301 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206260893 | NA | 1.09E-10 | mr1410 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206260893 | 1.06E-07 | NA | mr1170_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206260893 | 3.19E-07 | 9.14E-07 | mr1170_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206260893 | NA | 4.80E-06 | mr1233_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206260893 | 8.61E-06 | 8.61E-06 | mr1424_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206260893 | NA | 2.46E-06 | mr1609_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |