\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0206260893:

Variant ID: vg0206260893 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 6260893
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, G: 0.02, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


TTCTAGTATTGTCCACATTCATATATATGCTAATAATTTAGACATATATGTGTGTCTAGATTCATTAACATCTATATGAATATGGACAATGCTAGAAAGT[C/T]
TTATAACCTGAAACGGTCCGTAGGTAGTATTAGTGTATTACCACAGCTAATGACCAGCTTCTAGTATAAAGTTTATTACTGCAAGCGGTGAATTAATATA

Reverse complement sequence

TATATTAATTCACCGCTTGCAGTAATAAACTTTATACTAGAAGCTGGTCATTAGCTGTGGTAATACACTAATACTACCTACGGACCGTTTCAGGTTATAA[G/A]
ACTTTCTAGCATTGTCCATATTCATATAGATGTTAATGAATCTAGACACACATATATGTCTAAATTATTAGCATATATATGAATGTGGACAATACTAGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.40% 6.40% 0.70% 59.50% NA
All Indica  2759 1.90% 10.80% 1.09% 86.26% NA
All Japonica  1512 96.30% 0.20% 0.07% 3.44% NA
Aus  269 0.40% 0.00% 0.37% 99.26% NA
Indica I  595 2.20% 0.30% 1.01% 96.47% NA
Indica II  465 1.70% 24.10% 0.43% 73.76% NA
Indica III  913 1.20% 13.30% 1.20% 84.34% NA
Indica Intermediate  786 2.50% 7.90% 1.40% 88.17% NA
Temperate Japonica  767 97.40% 0.30% 0.13% 2.22% NA
Tropical Japonica  504 95.60% 0.20% 0.00% 4.17% NA
Japonica Intermediate  241 94.20% 0.00% 0.00% 5.81% NA
VI/Aromatic  96 31.20% 0.00% 0.00% 68.75% NA
Intermediate  90 44.40% 2.20% 1.11% 52.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0206260893 C -> T LOC_Os02g12040.1 upstream_gene_variant ; 4520.0bp to feature; MODIFIER silent_mutation Average:41.159; most accessible tissue: Zhenshan97 root, score: 68.289 N N N N
vg0206260893 C -> T LOC_Os02g12050.1 downstream_gene_variant ; 834.0bp to feature; MODIFIER silent_mutation Average:41.159; most accessible tissue: Zhenshan97 root, score: 68.289 N N N N
vg0206260893 C -> T LOC_Os02g12060.1 downstream_gene_variant ; 178.0bp to feature; MODIFIER silent_mutation Average:41.159; most accessible tissue: Zhenshan97 root, score: 68.289 N N N N
vg0206260893 C -> T LOC_Os02g12050-LOC_Os02g12060 intergenic_region ; MODIFIER silent_mutation Average:41.159; most accessible tissue: Zhenshan97 root, score: 68.289 N N N N
vg0206260893 C -> DEL N N silent_mutation Average:41.159; most accessible tissue: Zhenshan97 root, score: 68.289 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0206260893 NA 1.33E-09 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206260893 NA 1.09E-10 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206260893 1.06E-07 NA mr1170_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206260893 3.19E-07 9.14E-07 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206260893 NA 4.80E-06 mr1233_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206260893 8.61E-06 8.61E-06 mr1424_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206260893 NA 2.46E-06 mr1609_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251