\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0206245186:

Variant ID: vg0206245186 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 6245186
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.08, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


GTAGGCCATCTTTTATTGGCAAAATTTTACTTTGGACCTTTCTTAAACTAATCTTTCCATTTTGAATCGGGTAATTTTAACATTTTTTCGGTTTGGACTA[C/T]
CCTCAACGACTTCTTCATCACCCAACAACAACCTCACTCAAATTAGTTTGGGTACACCGATGAACTTCCTTGTCTATATGCAAGTCATATCTTCACTAGA

Reverse complement sequence

TCTAGTGAAGATATGACTTGCATATAGACAAGGAAGTTCATCGGTGTACCCAAACTAATTTGAGTGAGGTTGTTGTTGGGTGATGAAGAAGTCGTTGAGG[G/A]
TAGTCCAAACCGAAAAAATGTTAAAATTACCCGATTCAAAATGGAAAGATTAGTTTAAGAAAGGTCCAAAGTAAAATTTTGCCAATAAAAGATGGCCTAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.70% 44.90% 0.40% 0.00% NA
All Indica  2759 37.80% 61.60% 0.58% 0.00% NA
All Japonica  1512 96.80% 3.20% 0.07% 0.00% NA
Aus  269 2.20% 97.80% 0.00% 0.00% NA
Indica I  595 51.40% 47.90% 0.67% 0.00% NA
Indica II  465 50.10% 49.00% 0.86% 0.00% NA
Indica III  913 27.80% 71.90% 0.33% 0.00% NA
Indica Intermediate  786 31.80% 67.60% 0.64% 0.00% NA
Temperate Japonica  767 98.20% 1.80% 0.00% 0.00% NA
Tropical Japonica  504 95.80% 4.00% 0.20% 0.00% NA
Japonica Intermediate  241 94.20% 5.80% 0.00% 0.00% NA
VI/Aromatic  96 32.30% 66.70% 1.04% 0.00% NA
Intermediate  90 48.90% 50.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0206245186 C -> T LOC_Os02g12030.1 downstream_gene_variant ; 1897.0bp to feature; MODIFIER silent_mutation Average:51.59; most accessible tissue: Callus, score: 82.145 N N N N
vg0206245186 C -> T LOC_Os02g12020-LOC_Os02g12030 intergenic_region ; MODIFIER silent_mutation Average:51.59; most accessible tissue: Callus, score: 82.145 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0206245186 3.46E-07 3.21E-18 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206245186 3.90E-07 1.29E-11 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206245186 1.20E-07 8.28E-18 mr1170_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206245186 4.47E-06 2.02E-10 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206245186 NA 2.75E-07 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206245186 NA 2.28E-07 mr1743_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206245186 NA 2.22E-07 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251