| Variant ID: vg0206245186 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 6245186 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.08, others allele: 0.00, population size: 86. )
GTAGGCCATCTTTTATTGGCAAAATTTTACTTTGGACCTTTCTTAAACTAATCTTTCCATTTTGAATCGGGTAATTTTAACATTTTTTCGGTTTGGACTA[C/T]
CCTCAACGACTTCTTCATCACCCAACAACAACCTCACTCAAATTAGTTTGGGTACACCGATGAACTTCCTTGTCTATATGCAAGTCATATCTTCACTAGA
TCTAGTGAAGATATGACTTGCATATAGACAAGGAAGTTCATCGGTGTACCCAAACTAATTTGAGTGAGGTTGTTGTTGGGTGATGAAGAAGTCGTTGAGG[G/A]
TAGTCCAAACCGAAAAAATGTTAAAATTACCCGATTCAAAATGGAAAGATTAGTTTAAGAAAGGTCCAAAGTAAAATTTTGCCAATAAAAGATGGCCTAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.70% | 44.90% | 0.40% | 0.00% | NA |
| All Indica | 2759 | 37.80% | 61.60% | 0.58% | 0.00% | NA |
| All Japonica | 1512 | 96.80% | 3.20% | 0.07% | 0.00% | NA |
| Aus | 269 | 2.20% | 97.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 51.40% | 47.90% | 0.67% | 0.00% | NA |
| Indica II | 465 | 50.10% | 49.00% | 0.86% | 0.00% | NA |
| Indica III | 913 | 27.80% | 71.90% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 31.80% | 67.60% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 95.80% | 4.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 94.20% | 5.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 32.30% | 66.70% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 48.90% | 50.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0206245186 | C -> T | LOC_Os02g12030.1 | downstream_gene_variant ; 1897.0bp to feature; MODIFIER | silent_mutation | Average:51.59; most accessible tissue: Callus, score: 82.145 | N | N | N | N |
| vg0206245186 | C -> T | LOC_Os02g12020-LOC_Os02g12030 | intergenic_region ; MODIFIER | silent_mutation | Average:51.59; most accessible tissue: Callus, score: 82.145 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0206245186 | 3.46E-07 | 3.21E-18 | mr1170 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206245186 | 3.90E-07 | 1.29E-11 | mr1170 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206245186 | 1.20E-07 | 8.28E-18 | mr1170_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206245186 | 4.47E-06 | 2.02E-10 | mr1170_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206245186 | NA | 2.75E-07 | mr1691_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206245186 | NA | 2.28E-07 | mr1743_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206245186 | NA | 2.22E-07 | mr1749_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |