RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0206233846:

Variant ID: vg0206233846 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 6233846
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGGATTCTCGGTGGAGAATCCGAACTTTGGAAAACATCTTTGCGTCTCTACTTTGGTTTGCTTGTATTTTGAATTCTTGTCTTGATTTGTGCTTTTCTTT[A/G]
ATCTACTCGGTTGTGCATGTATTTGGGTGCAGGTGCTTCGTGGCTTTACGAAAGAACAACATATGACACACTGCACATTAGTTGCTTTGATCTAGAACTC

Reverse complement sequence

GAGTTCTAGATCAAAGCAACTAATGTGCAGTGTGTCATATGTTGTTCTTTCGTAAAGCCACGAAGCACCTGCACCCAAATACATGCACAACCGAGTAGAT[T/C]
AAAGAAAAGCACAAATCAAGACAAGAATTCAAAATACAAGCAAACCAAAGTAGAGACGCAAAGATGTTTTCCAAAGTTCGGATTCTCCACCGAGAATCCC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.50%	44.40%	0.15%	0.00%	NA
All Indica	2759	38.50%	61.30%	0.18%	0.00%	NA
All Japonica	1512	96.90%	3.10%	0.00%	0.00%	NA
Aus	269	2.20%	97.40%	0.37%	0.00%	NA
Indica I	595	52.40%	47.60%	0.00%	0.00%	NA
Indica II	465	50.80%	49.20%	0.00%	0.00%	NA
Indica III	913	28.00%	71.70%	0.22%	0.00%	NA
Indica Intermediate	786	33.00%	66.70%	0.38%	0.00%	NA
Temperate Japonica	767	98.20%	1.80%	0.00%	0.00%	NA
Tropical Japonica	504	95.80%	4.20%	0.00%	0.00%	NA
Japonica Intermediate	241	95.00%	5.00%	0.00%	0.00%	NA
VI/Aromatic	96	40.60%	59.40%	0.00%	0.00%	NA
Intermediate	90	54.40%	44.40%	1.11%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0206233846	A -> G	LOC_Os02g12010.1	upstream_gene_variant ; 1861.0bp to feature; MODIFIER	silent_mutation	Average:39.077; most accessible tissue: Callus, score: 57.026	N	N	N	N
vg0206233846	A -> G	LOC_Os02g12020.1	downstream_gene_variant ; 2860.0bp to feature; MODIFIER	silent_mutation	Average:39.077; most accessible tissue: Callus, score: 57.026	N	N	N	N
vg0206233846	A -> G	LOC_Os02g12010-LOC_Os02g12020	intergenic_region ; MODIFIER	silent_mutation	Average:39.077; most accessible tissue: Callus, score: 57.026	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0206233846	5.12E-08	5.64E-19	mr1170	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206233846	1.17E-07	1.33E-12	mr1170	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206233846	NA	2.15E-06	mr1740	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206233846	2.52E-07	8.60E-18	mr1170_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206233846	4.08E-06	1.10E-10	mr1170_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206233846	NA	6.91E-07	mr1691_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206233846	NA	4.40E-07	mr1743_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206233846	NA	3.09E-07	mr1749_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 8 of 8 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0206233846:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact