\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0206232457:

Variant ID: vg0206232457 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 6232457
Reference Allele: TAlternative Allele: A,TTTTTTTTTTGAACGACTC
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, A: 0.01, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


AACAAACTCTGCAATTTGCCTGATGCGCGTGGTCATTTGACGGGTTGAAAAAATGTCTGTACCAGCTCAGTTTGGTTGATGACTTTTTAACTGAATAACT[T/A,TTTTTTTTTTGAACGACTC]
GCATGCTGAAAAGGACTGAGTTGGACCATAGGTCGATACATGCACCCCACTAAAATAATAGCCTCCGTTGTTGACTAGAATACTCTTCTGTCCACATTGC

Reverse complement sequence

GCAATGTGGACAGAAGAGTATTCTAGTCAACAACGGAGGCTATTATTTTAGTGGGGTGCATGTATCGACCTATGGTCCAACTCAGTCCTTTTCAGCATGC[A/T,GAGTCGTTCAAAAAAAAAA]
AGTTATTCAGTTAAAAAGTCATCAACCAAACTGAGCTGGTACAGACATTTTTTCAACCCGTCAAATGACCACGCGCATCAGGCAAATTGCAGAGTTTGTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.00% 39.90% 0.83% 14.26% TTTTTTTTTTGAACGACTC: 0.02%
All Indica  2759 62.60% 12.10% 1.30% 24.03% NA
All Japonica  1512 2.20% 97.40% 0.13% 0.26% TTTTTTTTTTGAACGACTC: 0.07%
Aus  269 97.80% 1.10% 0.00% 1.12% NA
Indica I  595 49.60% 2.00% 1.85% 46.55% NA
Indica II  465 50.30% 26.50% 1.51% 21.72% NA
Indica III  913 72.20% 13.60% 0.77% 13.47% NA
Indica Intermediate  786 68.60% 9.40% 1.40% 20.61% NA
Temperate Japonica  767 1.80% 97.70% 0.00% 0.52% NA
Tropical Japonica  504 1.60% 97.80% 0.40% 0.00% TTTTTTTTTTGAACGACTC: 0.20%
Japonica Intermediate  241 4.60% 95.40% 0.00% 0.00% NA
VI/Aromatic  96 60.40% 39.60% 0.00% 0.00% NA
Intermediate  90 51.10% 43.30% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0206232457 T -> A LOC_Os02g12010.1 upstream_gene_variant ; 472.0bp to feature; MODIFIER silent_mutation Average:46.641; most accessible tissue: Callus, score: 98.026 N N N N
vg0206232457 T -> A LOC_Os02g12020.1 downstream_gene_variant ; 4249.0bp to feature; MODIFIER silent_mutation Average:46.641; most accessible tissue: Callus, score: 98.026 N N N N
vg0206232457 T -> A LOC_Os02g12010-LOC_Os02g12020 intergenic_region ; MODIFIER silent_mutation Average:46.641; most accessible tissue: Callus, score: 98.026 N N N N
vg0206232457 T -> TTTTTTTTTTGAACGACTC LOC_Os02g12010.1 upstream_gene_variant ; 473.0bp to feature; MODIFIER silent_mutation Average:46.641; most accessible tissue: Callus, score: 98.026 N N N N
vg0206232457 T -> TTTTTTTTTTGAACGACTC LOC_Os02g12020.1 downstream_gene_variant ; 4248.0bp to feature; MODIFIER silent_mutation Average:46.641; most accessible tissue: Callus, score: 98.026 N N N N
vg0206232457 T -> TTTTTTTTTTGAACGACTC LOC_Os02g12010-LOC_Os02g12020 intergenic_region ; MODIFIER silent_mutation Average:46.641; most accessible tissue: Callus, score: 98.026 N N N N
vg0206232457 T -> DEL N N silent_mutation Average:46.641; most accessible tissue: Callus, score: 98.026 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0206232457 T A -0.03 0.0 0.02 0.02 0.02 0.03
vg0206232457 T TTTTT* 0.37 0.15 0.1 -0.04 -0.03 -0.17

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0206232457 NA 2.09E-14 mr1059 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206232457 NA 2.61E-15 mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206232457 3.03E-09 9.80E-21 mr1170 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206232457 8.00E-08 2.50E-08 mr1170 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206232457 NA 6.00E-08 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206232457 NA 1.48E-07 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206232457 NA 5.43E-10 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206232457 NA 1.55E-07 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206232457 8.77E-08 3.72E-15 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206232457 6.99E-06 5.37E-08 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206232457 NA 8.80E-07 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206232457 NA 2.67E-06 mr1743_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206232457 NA 3.11E-07 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206232457 NA 3.77E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251