\
| Variant ID: vg0206231967 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 6231967 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, G: 0.04, others allele: 0.00, population size: 107. )
AGCAGGGCTTCTCTATCAGTGTCTGTGTCATCACTGATTGCTAATGGCAGGGAACTTGAGAAGATGAAGACAGCCAAGAGAGGAATGAGTTTTGGGCAGG[A/G]
AGCAAACAAGCGGATCATTTTGCTGTTGGTGCTGAGGGCAGTGAGGCTTGCTATTTTGCTTATGGCTAATATGTAGGAGGAGGCACGCACTTGCCTTATA
TATAAGGCAAGTGCGTGCCTCCTCCTACATATTAGCCATAAGCAAAATAGCAAGCCTCACTGCCCTCAGCACCAACAGCAAAATGATCCGCTTGTTTGCT[T/C]
CCTGCCCAAAACTCATTCCTCTCTTGGCTGTCTTCATCTTCTCAAGTTCCCTGCCATTAGCAATCAGTGATGACACAGACACTGATAGAGAAGCCCTGCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 44.60% | 40.40% | 0.13% | 14.85% | NA |
| All Indica | 2759 | 62.20% | 12.60% | 0.14% | 25.05% | NA |
| All Japonica | 1512 | 2.20% | 97.60% | 0.00% | 0.26% | NA |
| Aus | 269 | 97.80% | 0.70% | 0.37% | 1.12% | NA |
| Indica I | 595 | 48.70% | 2.20% | 0.50% | 48.57% | NA |
| Indica II | 465 | 49.70% | 26.70% | 0.22% | 23.44% | NA |
| Indica III | 913 | 72.20% | 14.20% | 0.00% | 13.58% | NA |
| Indica Intermediate | 786 | 68.20% | 10.30% | 0.00% | 21.50% | NA |
| Temperate Japonica | 767 | 1.80% | 97.70% | 0.00% | 0.52% | NA |
| Tropical Japonica | 504 | 1.60% | 98.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 4.60% | 95.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 58.30% | 41.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 44.40% | 50.00% | 1.11% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0206231967 | A -> G | LOC_Os02g12010.1 | missense_variant ; p.Ser7Pro; MODERATE | nonsynonymous_codon ; S7P | Average:44.458; most accessible tissue: Callus, score: 92.337 | benign |
1.394 |
TOLERATED | 0.26 |
| vg0206231967 | A -> DEL | LOC_Os02g12010.1 | N | frameshift_variant | Average:44.458; most accessible tissue: Callus, score: 92.337 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0206231967 | 3.39E-07 | 3.83E-19 | mr1170 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206231967 | 6.89E-06 | 2.13E-06 | mr1170 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206231967 | NA | 1.68E-09 | mr1301 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206231967 | NA | 3.12E-10 | mr1410 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206231967 | NA | 5.11E-10 | mr1714 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206231967 | NA | 1.80E-08 | mr1030_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206231967 | 1.93E-09 | 3.86E-16 | mr1170_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206231967 | 6.92E-08 | 1.06E-08 | mr1170_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206231967 | NA | 4.29E-07 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206231967 | NA | 5.30E-06 | mr1555_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206231967 | NA | 6.49E-08 | mr1609_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206231967 | NA | 1.76E-08 | mr1691_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206231967 | NA | 3.55E-07 | mr1743_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206231967 | NA | 3.95E-07 | mr1754_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206231967 | NA | 5.07E-06 | mr1754_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |