\
| Variant ID: vg0206177435 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 6177435 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.51, A: 0.50, others allele: 0.00, population size: 90. )
TCACAGTTTCAAAAAGTCCTCGTCCGTTCAACAAAATGTCCGTGTCCGATTCCATACAAAATATGATCAATGAATTTAAAAAAACGGTTTAAACATGAAT[G/A]
ACGTATCAAAATTTTAGCAAAAACATCTTCAATTTTTATAATAGTAGAGATTAATATAATTTTTTAAAAAAATCTATGTTACACAATTAGGGTTAATATG
CATATTAACCCTAATTGTGTAACATAGATTTTTTTAAAAAATTATATTAATCTCTACTATTATAAAAATTGAAGATGTTTTTGCTAAAATTTTGATACGT[C/T]
ATTCATGTTTAAACCGTTTTTTTAAATTCATTGATCATATTTTGTATGGAATCGGACACGGACATTTTGTTGAACGGACGAGGACTTTTTGAAACTGTGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.10% | 32.70% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 54.70% | 45.20% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 27.90% | 71.40% | 0.74% | 0.00% | NA |
| Indica I | 595 | 83.20% | 16.60% | 0.17% | 0.00% | NA |
| Indica II | 465 | 60.40% | 39.40% | 0.22% | 0.00% | NA |
| Indica III | 913 | 37.00% | 62.90% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 50.30% | 49.60% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 96.20% | 3.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 39.60% | 60.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 24.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0206177435 | G -> A | LOC_Os02g11920.1 | upstream_gene_variant ; 3647.0bp to feature; MODIFIER | silent_mutation | Average:53.915; most accessible tissue: Callus, score: 80.871 | N | N | N | N |
| vg0206177435 | G -> A | LOC_Os02g11920-LOC_Os02g11930 | intergenic_region ; MODIFIER | silent_mutation | Average:53.915; most accessible tissue: Callus, score: 80.871 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0206177435 | NA | 1.71E-06 | mr1004 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206177435 | NA | 4.54E-06 | mr1006 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206177435 | NA | 3.32E-06 | mr1007 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206177435 | NA | 4.51E-06 | mr1052 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206177435 | NA | 4.71E-06 | mr1097 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206177435 | NA | 9.56E-10 | mr1004_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206177435 | NA | 2.69E-07 | mr1006_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206177435 | NA | 3.89E-11 | mr1065_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206177435 | 7.06E-06 | NA | mr1091_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206177435 | 4.60E-06 | 1.33E-11 | mr1091_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206177435 | NA | 8.01E-06 | mr1092_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206177435 | NA | 2.81E-06 | mr1097_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206177435 | NA | 2.59E-08 | mr1112_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206177435 | NA | 4.61E-06 | mr1154_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206177435 | 2.44E-06 | NA | mr1877_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206177435 | 7.20E-06 | 3.40E-08 | mr1877_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |