\
| Variant ID: vg0206177063 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 6177063 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 119. )
ATTAGGACTCTGACTCTCATCTCAAGTTGGCATATGAGTTTTTTAAAAGAATTTCTTATACGACTCTTTGTGTATTTTTAAAAGCGAATAAACTTAAAAA[C/T]
TGATCAAATATAGACGATGTAGTATCGATGAAAATATCTTCAATTTATTTTTATAATAGTAAAGAAGATAAAGATAGAAATGGAGATTGCAAATTTTAGT
ACTAAAATTTGCAATCTCCATTTCTATCTTTATCTTCTTTACTATTATAAAAATAAATTGAAGATATTTTCATCGATACTACATCGTCTATATTTGATCA[G/A]
TTTTTAAGTTTATTCGCTTTTAAAAATACACAAAGAGTCGTATAAGAAATTCTTTTAAAAAACTCATATGCCAACTTGAGATGAGAGTCAGAGTCCTAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.50% | 23.40% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 60.80% | 39.10% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 84.00% | 16.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 61.30% | 38.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 47.00% | 53.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 58.90% | 40.70% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 14.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0206177063 | C -> T | LOC_Os02g11920.1 | upstream_gene_variant ; 3275.0bp to feature; MODIFIER | silent_mutation | Average:29.118; most accessible tissue: Callus, score: 57.107 | N | N | N | N |
| vg0206177063 | C -> T | LOC_Os02g11920-LOC_Os02g11930 | intergenic_region ; MODIFIER | silent_mutation | Average:29.118; most accessible tissue: Callus, score: 57.107 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0206177063 | 4.98E-06 | NA | mr1091_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206177063 | NA | 2.28E-10 | mr1091_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206177063 | NA | 4.93E-06 | mr1092_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206177063 | NA | 1.49E-06 | mr1097_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206177063 | NA | 1.98E-06 | mr1154_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206177063 | 5.97E-07 | NA | mr1877_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206177063 | 7.60E-06 | 5.51E-08 | mr1877_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |