\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0206177063:

Variant ID: vg0206177063 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 6177063
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:


ATTAGGACTCTGACTCTCATCTCAAGTTGGCATATGAGTTTTTTAAAAGAATTTCTTATACGACTCTTTGTGTATTTTTAAAAGCGAATAAACTTAAAAA[C/T]
TGATCAAATATAGACGATGTAGTATCGATGAAAATATCTTCAATTTATTTTTATAATAGTAAAGAAGATAAAGATAGAAATGGAGATTGCAAATTTTAGT

Reverse complement sequence

ACTAAAATTTGCAATCTCCATTTCTATCTTTATCTTCTTTACTATTATAAAAATAAATTGAAGATATTTTCATCGATACTACATCGTCTATATTTGATCA[G/A]
TTTTTAAGTTTATTCGCTTTTAAAAATACACAAAGAGTCGTATAAGAAATTCTTTTAAAAAACTCATATGCCAACTTGAGATGAGAGTCAGAGTCCTAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.50% 23.40% 0.06% 0.00% NA
All Indica  2759 60.80% 39.10% 0.11% 0.00% NA
All Japonica  1512 99.60% 0.40% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 84.00% 16.00% 0.00% 0.00% NA
Indica II  465 61.30% 38.70% 0.00% 0.00% NA
Indica III  913 47.00% 53.00% 0.00% 0.00% NA
Indica Intermediate  786 58.90% 40.70% 0.38% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0206177063 C -> T LOC_Os02g11920.1 upstream_gene_variant ; 3275.0bp to feature; MODIFIER silent_mutation Average:29.118; most accessible tissue: Callus, score: 57.107 N N N N
vg0206177063 C -> T LOC_Os02g11920-LOC_Os02g11930 intergenic_region ; MODIFIER silent_mutation Average:29.118; most accessible tissue: Callus, score: 57.107 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0206177063 4.98E-06 NA mr1091_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206177063 NA 2.28E-10 mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206177063 NA 4.93E-06 mr1092_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206177063 NA 1.49E-06 mr1097_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206177063 NA 1.98E-06 mr1154_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206177063 5.97E-07 NA mr1877_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206177063 7.60E-06 5.51E-08 mr1877_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251