\
| Variant ID: vg0206168898 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 6168898 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGACCGCCATGTCGACAACAGTTAGATAGGCTACCCACATATTGTACTGGTGTGATTATGGTGAATAAGAGCAATACCGGCTTCGGCCAACAAGATGTAG[G/T]
GTTATTACCTGACAACTCAGGGGCCCGAACCTGTATAAAAATCCCTGTCTCCATCTTTTTTATCTCAGTCTCGCGTATATCCTAGCACCAACGATCCTCG
CGAGGATCGTTGGTGCTAGGATATACGCGAGACTGAGATAAAAAAGATGGAGACAGGGATTTTTATACAGGTTCGGGCCCCTGAGTTGTCAGGTAATAAC[C/A]
CTACATCTTGTTGGCCGAAGCCGGTATTGCTCTTATTCACCATAATCACACCAGTACAATATGTGGGTAGCCTATCTAACTGTTGTCGACATGGCGGTCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.50% | 16.60% | 0.23% | 0.61% | NA |
| All Indica | 2759 | 71.00% | 27.70% | 0.36% | 0.94% | NA |
| All Japonica | 1512 | 99.60% | 0.20% | 0.00% | 0.20% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 81.50% | 14.80% | 0.34% | 3.36% | NA |
| Indica II | 465 | 84.90% | 15.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 60.60% | 39.20% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 66.90% | 31.60% | 0.76% | 0.76% | NA |
| Temperate Japonica | 767 | 99.60% | 0.00% | 0.00% | 0.39% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 11.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0206168898 | G -> T | LOC_Os02g11900.1 | upstream_gene_variant ; 4941.0bp to feature; MODIFIER | silent_mutation | Average:36.469; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0206168898 | G -> T | LOC_Os02g11910.1 | downstream_gene_variant ; 969.0bp to feature; MODIFIER | silent_mutation | Average:36.469; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0206168898 | G -> T | LOC_Os02g11920.1 | downstream_gene_variant ; 3473.0bp to feature; MODIFIER | silent_mutation | Average:36.469; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0206168898 | G -> T | LOC_Os02g11910-LOC_Os02g11920 | intergenic_region ; MODIFIER | silent_mutation | Average:36.469; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0206168898 | G -> DEL | N | N | silent_mutation | Average:36.469; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0206168898 | 6.27E-09 | NA | mr1091_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206168898 | 4.27E-08 | 1.18E-12 | mr1091_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206168898 | 1.83E-06 | NA | mr1094_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206168898 | 9.24E-06 | 1.41E-09 | mr1094_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206168898 | 9.37E-06 | NA | mr1096_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206168898 | 8.96E-06 | 6.51E-08 | mr1096_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |