Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0206168898:

Variant ID: vg0206168898 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 6168898
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGACCGCCATGTCGACAACAGTTAGATAGGCTACCCACATATTGTACTGGTGTGATTATGGTGAATAAGAGCAATACCGGCTTCGGCCAACAAGATGTAG[G/T]
GTTATTACCTGACAACTCAGGGGCCCGAACCTGTATAAAAATCCCTGTCTCCATCTTTTTTATCTCAGTCTCGCGTATATCCTAGCACCAACGATCCTCG

Reverse complement sequence

CGAGGATCGTTGGTGCTAGGATATACGCGAGACTGAGATAAAAAAGATGGAGACAGGGATTTTTATACAGGTTCGGGCCCCTGAGTTGTCAGGTAATAAC[C/A]
CTACATCTTGTTGGCCGAAGCCGGTATTGCTCTTATTCACCATAATCACACCAGTACAATATGTGGGTAGCCTATCTAACTGTTGTCGACATGGCGGTCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.50%	16.60%	0.23%	0.61%	NA
All Indica	2759	71.00%	27.70%	0.36%	0.94%	NA
All Japonica	1512	99.60%	0.20%	0.00%	0.20%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	81.50%	14.80%	0.34%	3.36%	NA
Indica II	465	84.90%	15.10%	0.00%	0.00%	NA
Indica III	913	60.60%	39.20%	0.22%	0.00%	NA
Indica Intermediate	786	66.90%	31.60%	0.76%	0.76%	NA
Temperate Japonica	767	99.60%	0.00%	0.00%	0.39%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	91.70%	8.30%	0.00%	0.00%	NA
Intermediate	90	87.80%	11.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0206168898	G -> T	LOC_Os02g11900.1	upstream_gene_variant ; 4941.0bp to feature; MODIFIER	silent_mutation	Average:36.469; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0206168898	G -> T	LOC_Os02g11910.1	downstream_gene_variant ; 969.0bp to feature; MODIFIER	silent_mutation	Average:36.469; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0206168898	G -> T	LOC_Os02g11920.1	downstream_gene_variant ; 3473.0bp to feature; MODIFIER	silent_mutation	Average:36.469; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0206168898	G -> T	LOC_Os02g11910-LOC_Os02g11920	intergenic_region ; MODIFIER	silent_mutation	Average:36.469; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg0206168898	G -> DEL	N	N	silent_mutation	Average:36.469; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0206168898	6.27E-09	NA	mr1091_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206168898	4.27E-08	1.18E-12	mr1091_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206168898	1.83E-06	NA	mr1094_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206168898	9.24E-06	1.41E-09	mr1094_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206168898	9.37E-06	NA	mr1096_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206168898	8.96E-06	6.51E-08	mr1096_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251