Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0206163454:

Variant ID: vg0206163454 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 6163454
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TATTTGTGGGGAGAAATTTGTTCATCTCTCGACAGGAAATCCCTTCGTTTCTTTATTATCTTTTAAAAATATTAATAAGATAGTTTTATATTAGATATAT[C/T]
GCTTCACAAAACATATAAGTTTAAATTTGACTTCTATAAATTGAATATTCATAAAAAAATATACCTGTAAAAGTACACATAATAGTTTCAGTTTGTGCTT

Reverse complement sequence

AAGCACAAACTGAAACTATTATGTGTACTTTTACAGGTATATTTTTTTATGAATATTCAATTTATAGAAGTCAAATTTAAACTTATATGTTTTGTGAAGC[G/A]
ATATATCTAATATAAAACTATCTTATTAATATTTTTAAAAGATAATAAAGAAACGAAGGGATTTCCTGTCGAGAGATGAACAAATTTCTCCCCACAAATA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.90%	17.00%	0.06%	0.00%	NA
All Indica	2759	71.50%	28.40%	0.07%	0.00%	NA
All Japonica	1512	99.80%	0.10%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	85.00%	15.00%	0.00%	0.00%	NA
Indica II	465	84.90%	15.10%	0.00%	0.00%	NA
Indica III	913	59.80%	40.10%	0.11%	0.00%	NA
Indica Intermediate	786	67.00%	32.80%	0.13%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.40%	0.41%	0.00%	NA
VI/Aromatic	96	91.70%	8.30%	0.00%	0.00%	NA
Intermediate	90	88.90%	11.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0206163454	C -> T	LOC_Os02g11890.1	upstream_gene_variant ; 3463.0bp to feature; MODIFIER	silent_mutation	Average:32.9; most accessible tissue: Callus, score: 79.233	N	N	N	N
vg0206163454	C -> T	LOC_Os02g11910.1	upstream_gene_variant ; 3561.0bp to feature; MODIFIER	silent_mutation	Average:32.9; most accessible tissue: Callus, score: 79.233	N	N	N	N
vg0206163454	C -> T	LOC_Os02g11900.1	downstream_gene_variant ; 21.0bp to feature; MODIFIER	silent_mutation	Average:32.9; most accessible tissue: Callus, score: 79.233	N	N	N	N
vg0206163454	C -> T	LOC_Os02g11890-LOC_Os02g11900	intergenic_region ; MODIFIER	silent_mutation	Average:32.9; most accessible tissue: Callus, score: 79.233	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0206163454	NA	5.46E-09	mr1063_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206163454	1.20E-07	NA	mr1091_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206163454	7.28E-07	4.53E-13	mr1091_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206163454	NA	7.34E-06	mr1092_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206163454	1.09E-06	NA	mr1094_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206163454	3.11E-06	1.64E-09	mr1094_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206163454	NA	1.35E-07	mr1096_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206163454	NA	1.40E-07	mr1170_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206163454	NA	1.65E-07	mr1260_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206163454	7.38E-06	NA	mr1877_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206163454	NA	5.59E-07	mr1877_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251