\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0206163454:

Variant ID: vg0206163454 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 6163454
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATTTGTGGGGAGAAATTTGTTCATCTCTCGACAGGAAATCCCTTCGTTTCTTTATTATCTTTTAAAAATATTAATAAGATAGTTTTATATTAGATATAT[C/T]
GCTTCACAAAACATATAAGTTTAAATTTGACTTCTATAAATTGAATATTCATAAAAAAATATACCTGTAAAAGTACACATAATAGTTTCAGTTTGTGCTT

Reverse complement sequence

AAGCACAAACTGAAACTATTATGTGTACTTTTACAGGTATATTTTTTTATGAATATTCAATTTATAGAAGTCAAATTTAAACTTATATGTTTTGTGAAGC[G/A]
ATATATCTAATATAAAACTATCTTATTAATATTTTTAAAAGATAATAAAGAAACGAAGGGATTTCCTGTCGAGAGATGAACAAATTTCTCCCCACAAATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.90% 17.00% 0.06% 0.00% NA
All Indica  2759 71.50% 28.40% 0.07% 0.00% NA
All Japonica  1512 99.80% 0.10% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 85.00% 15.00% 0.00% 0.00% NA
Indica II  465 84.90% 15.10% 0.00% 0.00% NA
Indica III  913 59.80% 40.10% 0.11% 0.00% NA
Indica Intermediate  786 67.00% 32.80% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.41% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0206163454 C -> T LOC_Os02g11890.1 upstream_gene_variant ; 3463.0bp to feature; MODIFIER silent_mutation Average:32.9; most accessible tissue: Callus, score: 79.233 N N N N
vg0206163454 C -> T LOC_Os02g11910.1 upstream_gene_variant ; 3561.0bp to feature; MODIFIER silent_mutation Average:32.9; most accessible tissue: Callus, score: 79.233 N N N N
vg0206163454 C -> T LOC_Os02g11900.1 downstream_gene_variant ; 21.0bp to feature; MODIFIER silent_mutation Average:32.9; most accessible tissue: Callus, score: 79.233 N N N N
vg0206163454 C -> T LOC_Os02g11890-LOC_Os02g11900 intergenic_region ; MODIFIER silent_mutation Average:32.9; most accessible tissue: Callus, score: 79.233 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0206163454 NA 5.46E-09 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206163454 1.20E-07 NA mr1091_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206163454 7.28E-07 4.53E-13 mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206163454 NA 7.34E-06 mr1092_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206163454 1.09E-06 NA mr1094_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206163454 3.11E-06 1.64E-09 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206163454 NA 1.35E-07 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206163454 NA 1.40E-07 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206163454 NA 1.65E-07 mr1260_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206163454 7.38E-06 NA mr1877_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206163454 NA 5.59E-07 mr1877_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251