\
| Variant ID: vg0206158957 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 6158957 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GTTTTTCATCGTTTTCTTATTGGTTTATCAGTTATCACGGTCAGGTTTAATGTTTCGGATATTAATTTCAATAATTTTAGAGATTATTGTCCTATAGTCC[G/T]
CGATAGGACATTATGATCTCTGAAATATTTATTTTTTTAATCAAGCATTTTTGAAGTTCAACATAAATTTGTTAAAGCTTTAACTTGTTTGATTCCGAAA
TTTCGGAATCAAACAAGTTAAAGCTTTAACAAATTTATGTTGAACTTCAAAAATGCTTGATTAAAAAAATAAATATTTCAGAGATCATAATGTCCTATCG[C/A]
GGACTATAGGACAATAATCTCTAAAATTATTGAAATTAATATCCGAAACATTAAACCTGACCGTGATAACTGATAAACCAATAAGAAAACGATGAAAAAC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.50% | 31.10% | 0.13% | 12.19% | NA |
| All Indica | 2759 | 81.60% | 0.80% | 0.18% | 17.47% | NA |
| All Japonica | 1512 | 3.20% | 92.00% | 0.07% | 4.70% | NA |
| Aus | 269 | 98.90% | 0.40% | 0.00% | 0.74% | NA |
| Indica I | 595 | 74.50% | 0.20% | 0.34% | 25.04% | NA |
| Indica II | 465 | 79.80% | 0.60% | 0.00% | 19.57% | NA |
| Indica III | 913 | 84.60% | 0.40% | 0.22% | 14.79% | NA |
| Indica Intermediate | 786 | 84.50% | 1.80% | 0.13% | 13.61% | NA |
| Temperate Japonica | 767 | 2.60% | 88.80% | 0.13% | 8.47% | NA |
| Tropical Japonica | 504 | 3.40% | 96.00% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 5.00% | 93.80% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 62.50% | 20.80% | 0.00% | 16.67% | NA |
| Intermediate | 90 | 52.20% | 42.20% | 0.00% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0206158957 | G -> T | LOC_Os02g11880.1 | upstream_gene_variant ; 3802.0bp to feature; MODIFIER | silent_mutation | Average:53.377; most accessible tissue: Callus, score: 78.601 | N | N | N | N |
| vg0206158957 | G -> T | LOC_Os02g11900.1 | downstream_gene_variant ; 4518.0bp to feature; MODIFIER | silent_mutation | Average:53.377; most accessible tissue: Callus, score: 78.601 | N | N | N | N |
| vg0206158957 | G -> T | LOC_Os02g11890.1 | intron_variant ; MODIFIER | silent_mutation | Average:53.377; most accessible tissue: Callus, score: 78.601 | N | N | N | N |
| vg0206158957 | G -> DEL | N | N | silent_mutation | Average:53.377; most accessible tissue: Callus, score: 78.601 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0206158957 | NA | 9.94E-22 | mr1122 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206158957 | NA | 5.85E-46 | mr1136 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206158957 | NA | 2.22E-21 | mr1168 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206158957 | NA | 3.99E-10 | mr1175 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206158957 | NA | 1.72E-23 | mr1383 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206158957 | NA | 3.58E-18 | mr1557 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206158957 | NA | 8.24E-14 | mr1653 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206158957 | NA | 1.20E-18 | mr1715 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206158957 | NA | 1.86E-57 | mr1136_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206158957 | NA | 7.38E-32 | mr1137_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206158957 | NA | 4.04E-24 | mr1383_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206158957 | NA | 1.87E-33 | mr1448_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206158957 | NA | 3.89E-28 | mr1617_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206158957 | NA | 3.50E-19 | mr1637_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206158957 | NA | 4.23E-18 | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |