\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0206102860:

Variant ID: vg0206102860 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 6102860
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCTAGTCACGGGAGGGGGCGGTCGCCGCCCGACCTCGGGCCCGATCTCCCCTCGAGGGAGGGCCACGTGGCGCCTGGGGCAGCCTTCTCCCTCTAGTCTC[G/A]
GCCAGGGAGTGGCCGCCACCCTACCTCAGGCCCGATCCCCCTCGGGGGAGGGCCACGTGGCATTGGGGGGCAGCCTCCTCCGTCCAATCTCTGGGAGGGA

Reverse complement sequence

TCCCTCCCAGAGATTGGACGGAGGAGGCTGCCCCCCAATGCCACGTGGCCCTCCCCCGAGGGGGATCGGGCCTGAGGTAGGGTGGCGGCCACTCCCTGGC[C/T]
GAGACTAGAGGGAGAAGGCTGCCCCAGGCGCCACGTGGCCCTCCCTCGAGGGGAGATCGGGCCCGAGGTCGGGCGGCGACCGCCCCCTCCCGTGACTAGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.20% 9.00% 1.14% 12.72% NA
All Indica  2759 75.90% 3.90% 1.74% 18.41% NA
All Japonica  1512 94.20% 0.80% 0.33% 4.70% NA
Aus  269 10.00% 89.60% 0.00% 0.37% NA
Indica I  595 66.90% 0.20% 6.39% 26.55% NA
Indica II  465 77.40% 0.40% 0.86% 21.29% NA
Indica III  913 79.30% 4.50% 0.22% 15.99% NA
Indica Intermediate  786 78.00% 8.10% 0.51% 13.36% NA
Temperate Japonica  767 90.90% 0.00% 0.65% 8.47% NA
Tropical Japonica  504 97.80% 1.60% 0.00% 0.60% NA
Japonica Intermediate  241 97.10% 1.70% 0.00% 1.24% NA
VI/Aromatic  96 29.20% 54.20% 1.04% 15.62% NA
Intermediate  90 82.20% 11.10% 0.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0206102860 G -> A LOC_Os02g11800.1 downstream_gene_variant ; 1803.0bp to feature; MODIFIER silent_mutation Average:43.092; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg0206102860 G -> A LOC_Os02g11810.1 downstream_gene_variant ; 3683.0bp to feature; MODIFIER silent_mutation Average:43.092; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg0206102860 G -> A LOC_Os02g11790-LOC_Os02g11800 intergenic_region ; MODIFIER silent_mutation Average:43.092; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg0206102860 G -> DEL N N silent_mutation Average:43.092; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0206102860 NA 2.19E-06 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206102860 4.85E-06 NA mr1090 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206102860 NA 6.28E-08 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206102860 NA 4.52E-07 mr1415 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206102860 NA 2.01E-09 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206102860 NA 4.52E-07 mr1567 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206102860 NA 5.60E-07 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206102860 NA 1.19E-16 mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206102860 6.89E-07 NA mr1078_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206102860 7.30E-06 NA mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206102860 1.56E-08 NA mr1090_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206102860 NA 2.90E-10 mr1126_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206102860 NA 2.54E-10 mr1166_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206102860 5.14E-07 NA mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206102860 NA 1.50E-07 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206102860 NA 3.62E-06 mr1762_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206102860 NA 3.32E-09 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251