\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0206102808:

Variant ID: vg0206102808 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 6102808
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACCTAACCCACCGTACGTGGTGACCTAGAGAGGGGGTCGGGGGAGTCCGACCCCTAGTCACGGGAGGGGGCGGTCGCCGCCCGACCTCGGGCCCGATCTC[C/T]
CCTCGAGGGAGGGCCACGTGGCGCCTGGGGCAGCCTTCTCCCTCTAGTCTCGGCCAGGGAGTGGCCGCCACCCTACCTCAGGCCCGATCCCCCTCGGGGG

Reverse complement sequence

CCCCCGAGGGGGATCGGGCCTGAGGTAGGGTGGCGGCCACTCCCTGGCCGAGACTAGAGGGAGAAGGCTGCCCCAGGCGCCACGTGGCCCTCCCTCGAGG[G/A]
GAGATCGGGCCCGAGGTCGGGCGGCGACCGCCCCCTCCCGTGACTAGGGGTCGGACTCCCCCGACCCCCTCTCTAGGTCACCACGTACGGTGGGTTAGGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.30% 35.90% 1.71% 13.10% NA
All Indica  2759 30.70% 47.90% 2.50% 18.92% NA
All Japonica  1512 92.70% 2.10% 0.13% 5.09% NA
Aus  269 2.60% 94.40% 2.60% 0.37% NA
Indica I  595 12.10% 51.10% 5.88% 30.92% NA
Indica II  465 16.10% 60.60% 1.94% 21.29% NA
Indica III  913 45.70% 38.00% 1.64% 14.68% NA
Indica Intermediate  786 35.90% 49.50% 1.27% 13.36% NA
Temperate Japonica  767 88.90% 1.70% 0.13% 9.26% NA
Tropical Japonica  504 97.20% 2.20% 0.00% 0.60% NA
Japonica Intermediate  241 95.40% 2.90% 0.41% 1.24% NA
VI/Aromatic  96 29.20% 54.20% 2.08% 14.58% NA
Intermediate  90 50.00% 43.30% 1.11% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0206102808 C -> T LOC_Os02g11800.1 downstream_gene_variant ; 1855.0bp to feature; MODIFIER silent_mutation Average:42.271; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg0206102808 C -> T LOC_Os02g11810.1 downstream_gene_variant ; 3735.0bp to feature; MODIFIER silent_mutation Average:42.271; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg0206102808 C -> T LOC_Os02g11790-LOC_Os02g11800 intergenic_region ; MODIFIER silent_mutation Average:42.271; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg0206102808 C -> DEL N N silent_mutation Average:42.271; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0206102808 3.47E-06 3.92E-06 mr1085 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206102808 NA 8.62E-06 mr1374 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206102808 NA 1.22E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206102808 NA 2.95E-07 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206102808 NA 4.86E-14 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206102808 NA 3.94E-14 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206102808 NA 3.51E-12 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206102808 1.70E-06 4.74E-06 mr1949 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206102808 NA 2.57E-07 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251