Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0206102808:

Variant ID: vg0206102808 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 6102808
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACCTAACCCACCGTACGTGGTGACCTAGAGAGGGGGTCGGGGGAGTCCGACCCCTAGTCACGGGAGGGGGCGGTCGCCGCCCGACCTCGGGCCCGATCTC[C/T]
CCTCGAGGGAGGGCCACGTGGCGCCTGGGGCAGCCTTCTCCCTCTAGTCTCGGCCAGGGAGTGGCCGCCACCCTACCTCAGGCCCGATCCCCCTCGGGGG

Reverse complement sequence

CCCCCGAGGGGGATCGGGCCTGAGGTAGGGTGGCGGCCACTCCCTGGCCGAGACTAGAGGGAGAAGGCTGCCCCAGGCGCCACGTGGCCCTCCCTCGAGG[G/A]
GAGATCGGGCCCGAGGTCGGGCGGCGACCGCCCCCTCCCGTGACTAGGGGTCGGACTCCCCCGACCCCCTCTCTAGGTCACCACGTACGGTGGGTTAGGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.30%	35.90%	1.71%	13.10%	NA
All Indica	2759	30.70%	47.90%	2.50%	18.92%	NA
All Japonica	1512	92.70%	2.10%	0.13%	5.09%	NA
Aus	269	2.60%	94.40%	2.60%	0.37%	NA
Indica I	595	12.10%	51.10%	5.88%	30.92%	NA
Indica II	465	16.10%	60.60%	1.94%	21.29%	NA
Indica III	913	45.70%	38.00%	1.64%	14.68%	NA
Indica Intermediate	786	35.90%	49.50%	1.27%	13.36%	NA
Temperate Japonica	767	88.90%	1.70%	0.13%	9.26%	NA
Tropical Japonica	504	97.20%	2.20%	0.00%	0.60%	NA
Japonica Intermediate	241	95.40%	2.90%	0.41%	1.24%	NA
VI/Aromatic	96	29.20%	54.20%	2.08%	14.58%	NA
Intermediate	90	50.00%	43.30%	1.11%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0206102808	C -> T	LOC_Os02g11800.1	downstream_gene_variant ; 1855.0bp to feature; MODIFIER	silent_mutation	Average:42.271; most accessible tissue: Minghui63 panicle, score: 74.563	N	N	N	N
vg0206102808	C -> T	LOC_Os02g11810.1	downstream_gene_variant ; 3735.0bp to feature; MODIFIER	silent_mutation	Average:42.271; most accessible tissue: Minghui63 panicle, score: 74.563	N	N	N	N
vg0206102808	C -> T	LOC_Os02g11790-LOC_Os02g11800	intergenic_region ; MODIFIER	silent_mutation	Average:42.271; most accessible tissue: Minghui63 panicle, score: 74.563	N	N	N	N
vg0206102808	C -> DEL	N	N	silent_mutation	Average:42.271; most accessible tissue: Minghui63 panicle, score: 74.563	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0206102808	3.47E-06	3.92E-06	mr1085	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206102808	NA	8.62E-06	mr1374	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206102808	NA	1.22E-06	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206102808	NA	2.95E-07	mr1633	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206102808	NA	4.86E-14	mr1653	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206102808	NA	3.94E-14	mr1909	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206102808	NA	3.51E-12	mr1921	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206102808	1.70E-06	4.74E-06	mr1949	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206102808	NA	2.57E-07	mr1921_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251