\
| Variant ID: vg0206102808 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 6102808 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ACCTAACCCACCGTACGTGGTGACCTAGAGAGGGGGTCGGGGGAGTCCGACCCCTAGTCACGGGAGGGGGCGGTCGCCGCCCGACCTCGGGCCCGATCTC[C/T]
CCTCGAGGGAGGGCCACGTGGCGCCTGGGGCAGCCTTCTCCCTCTAGTCTCGGCCAGGGAGTGGCCGCCACCCTACCTCAGGCCCGATCCCCCTCGGGGG
CCCCCGAGGGGGATCGGGCCTGAGGTAGGGTGGCGGCCACTCCCTGGCCGAGACTAGAGGGAGAAGGCTGCCCCAGGCGCCACGTGGCCCTCCCTCGAGG[G/A]
GAGATCGGGCCCGAGGTCGGGCGGCGACCGCCCCCTCCCGTGACTAGGGGTCGGACTCCCCCGACCCCCTCTCTAGGTCACCACGTACGGTGGGTTAGGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.30% | 35.90% | 1.71% | 13.10% | NA |
| All Indica | 2759 | 30.70% | 47.90% | 2.50% | 18.92% | NA |
| All Japonica | 1512 | 92.70% | 2.10% | 0.13% | 5.09% | NA |
| Aus | 269 | 2.60% | 94.40% | 2.60% | 0.37% | NA |
| Indica I | 595 | 12.10% | 51.10% | 5.88% | 30.92% | NA |
| Indica II | 465 | 16.10% | 60.60% | 1.94% | 21.29% | NA |
| Indica III | 913 | 45.70% | 38.00% | 1.64% | 14.68% | NA |
| Indica Intermediate | 786 | 35.90% | 49.50% | 1.27% | 13.36% | NA |
| Temperate Japonica | 767 | 88.90% | 1.70% | 0.13% | 9.26% | NA |
| Tropical Japonica | 504 | 97.20% | 2.20% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 95.40% | 2.90% | 0.41% | 1.24% | NA |
| VI/Aromatic | 96 | 29.20% | 54.20% | 2.08% | 14.58% | NA |
| Intermediate | 90 | 50.00% | 43.30% | 1.11% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0206102808 | C -> T | LOC_Os02g11800.1 | downstream_gene_variant ; 1855.0bp to feature; MODIFIER | silent_mutation | Average:42.271; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg0206102808 | C -> T | LOC_Os02g11810.1 | downstream_gene_variant ; 3735.0bp to feature; MODIFIER | silent_mutation | Average:42.271; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg0206102808 | C -> T | LOC_Os02g11790-LOC_Os02g11800 | intergenic_region ; MODIFIER | silent_mutation | Average:42.271; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg0206102808 | C -> DEL | N | N | silent_mutation | Average:42.271; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0206102808 | 3.47E-06 | 3.92E-06 | mr1085 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206102808 | NA | 8.62E-06 | mr1374 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206102808 | NA | 1.22E-06 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206102808 | NA | 2.95E-07 | mr1633 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206102808 | NA | 4.86E-14 | mr1653 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206102808 | NA | 3.94E-14 | mr1909 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206102808 | NA | 3.51E-12 | mr1921 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206102808 | 1.70E-06 | 4.74E-06 | mr1949 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206102808 | NA | 2.57E-07 | mr1921_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |