\
| Variant ID: vg0206101249 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 6101249 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GTCCCTGGCTTCGACGGCACCCGGAGCTCAACTTAAGGCTGGAATAGGGCTAGAAAACTTAGCCCCCACACTTGGCGAGGAAACGTTCATGTAGATGAGA[A/G]
AGAGGTTGGGCTCTTACCACCGAGGAAGCAAACGAATGCGCAATACACGAGCGTCACAGGGCCATGAGAAAAGAATGGGGGAAAAGAAATATAAGACTTC
GAAGTCTTATATTTCTTTTCCCCCATTCTTTTCTCATGGCCCTGTGACGCTCGTGTATTGCGCATTCGTTTGCTTCCTCGGTGGTAAGAGCCCAACCTCT[T/C]
TCTCATCTACATGAACGTTTCCTCGCCAAGTGTGGGGGCTAAGTTTTCTAGCCCTATTCCAGCCTTAAGTTGAGCTCCGGGTGCCGTCGAAGCCAGGGAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.90% | 31.10% | 1.21% | 28.76% | NA |
| All Indica | 2759 | 52.00% | 0.90% | 2.03% | 45.02% | NA |
| All Japonica | 1512 | 2.90% | 91.90% | 0.00% | 5.22% | NA |
| Aus | 269 | 99.30% | 0.40% | 0.00% | 0.37% | NA |
| Indica I | 595 | 56.50% | 0.30% | 1.18% | 42.02% | NA |
| Indica II | 465 | 62.80% | 0.90% | 1.29% | 35.05% | NA |
| Indica III | 913 | 43.30% | 0.80% | 3.18% | 52.79% | NA |
| Indica Intermediate | 786 | 52.50% | 1.50% | 1.78% | 44.15% | NA |
| Temperate Japonica | 767 | 1.80% | 88.90% | 0.00% | 9.26% | NA |
| Tropical Japonica | 504 | 4.00% | 95.40% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 4.10% | 93.80% | 0.00% | 2.07% | NA |
| VI/Aromatic | 96 | 56.20% | 19.80% | 0.00% | 23.96% | NA |
| Intermediate | 90 | 43.30% | 40.00% | 1.11% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0206101249 | A -> G | LOC_Os02g11800.1 | downstream_gene_variant ; 3414.0bp to feature; MODIFIER | silent_mutation | Average:27.823; most accessible tissue: Minghui63 root, score: 55.188 | N | N | N | N |
| vg0206101249 | A -> G | LOC_Os02g11790-LOC_Os02g11800 | intergenic_region ; MODIFIER | silent_mutation | Average:27.823; most accessible tissue: Minghui63 root, score: 55.188 | N | N | N | N |
| vg0206101249 | A -> DEL | N | N | silent_mutation | Average:27.823; most accessible tissue: Minghui63 root, score: 55.188 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0206101249 | 4.94E-06 | 7.89E-06 | mr1277 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206101249 | NA | 3.66E-23 | mr1383 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206101249 | NA | 2.37E-19 | mr1557 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206101249 | NA | 1.25E-13 | mr1641 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206101249 | NA | 1.53E-06 | mr1646 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206101249 | NA | 1.52E-16 | mr1653 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206101249 | NA | 1.89E-20 | mr1715 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206101249 | NA | 4.27E-34 | mr1944 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206101249 | NA | 2.37E-06 | mr1358_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206101249 | NA | 2.48E-09 | mr1379_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206101249 | NA | 9.09E-09 | mr1576_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206101249 | NA | 2.38E-08 | mr1749_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206101249 | NA | 9.99E-08 | mr1821_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |