\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0206101249:

Variant ID: vg0206101249 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 6101249
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTCCCTGGCTTCGACGGCACCCGGAGCTCAACTTAAGGCTGGAATAGGGCTAGAAAACTTAGCCCCCACACTTGGCGAGGAAACGTTCATGTAGATGAGA[A/G]
AGAGGTTGGGCTCTTACCACCGAGGAAGCAAACGAATGCGCAATACACGAGCGTCACAGGGCCATGAGAAAAGAATGGGGGAAAAGAAATATAAGACTTC

Reverse complement sequence

GAAGTCTTATATTTCTTTTCCCCCATTCTTTTCTCATGGCCCTGTGACGCTCGTGTATTGCGCATTCGTTTGCTTCCTCGGTGGTAAGAGCCCAACCTCT[T/C]
TCTCATCTACATGAACGTTTCCTCGCCAAGTGTGGGGGCTAAGTTTTCTAGCCCTATTCCAGCCTTAAGTTGAGCTCCGGGTGCCGTCGAAGCCAGGGAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.90% 31.10% 1.21% 28.76% NA
All Indica  2759 52.00% 0.90% 2.03% 45.02% NA
All Japonica  1512 2.90% 91.90% 0.00% 5.22% NA
Aus  269 99.30% 0.40% 0.00% 0.37% NA
Indica I  595 56.50% 0.30% 1.18% 42.02% NA
Indica II  465 62.80% 0.90% 1.29% 35.05% NA
Indica III  913 43.30% 0.80% 3.18% 52.79% NA
Indica Intermediate  786 52.50% 1.50% 1.78% 44.15% NA
Temperate Japonica  767 1.80% 88.90% 0.00% 9.26% NA
Tropical Japonica  504 4.00% 95.40% 0.00% 0.60% NA
Japonica Intermediate  241 4.10% 93.80% 0.00% 2.07% NA
VI/Aromatic  96 56.20% 19.80% 0.00% 23.96% NA
Intermediate  90 43.30% 40.00% 1.11% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0206101249 A -> G LOC_Os02g11800.1 downstream_gene_variant ; 3414.0bp to feature; MODIFIER silent_mutation Average:27.823; most accessible tissue: Minghui63 root, score: 55.188 N N N N
vg0206101249 A -> G LOC_Os02g11790-LOC_Os02g11800 intergenic_region ; MODIFIER silent_mutation Average:27.823; most accessible tissue: Minghui63 root, score: 55.188 N N N N
vg0206101249 A -> DEL N N silent_mutation Average:27.823; most accessible tissue: Minghui63 root, score: 55.188 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0206101249 4.94E-06 7.89E-06 mr1277 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206101249 NA 3.66E-23 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206101249 NA 2.37E-19 mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206101249 NA 1.25E-13 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206101249 NA 1.53E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206101249 NA 1.52E-16 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206101249 NA 1.89E-20 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206101249 NA 4.27E-34 mr1944 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206101249 NA 2.37E-06 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206101249 NA 2.48E-09 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206101249 NA 9.09E-09 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206101249 NA 2.38E-08 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206101249 NA 9.99E-08 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251