| Variant ID: vg0206101217 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 6101217 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGCTAGCCGCTACGGAAGAGCCAGCACAGGGGGTCCCTGGCTTCGACGGCACCCGGAGCTCAACTTAAGGCTGGAATAGGGCTAGAAAACTTAGCCCCCA[C/T]
ACTTGGCGAGGAAACGTTCATGTAGATGAGAAAGAGGTTGGGCTCTTACCACCGAGGAAGCAAACGAATGCGCAATACACGAGCGTCACAGGGCCATGAG
CTCATGGCCCTGTGACGCTCGTGTATTGCGCATTCGTTTGCTTCCTCGGTGGTAAGAGCCCAACCTCTTTCTCATCTACATGAACGTTTCCTCGCCAAGT[G/A]
TGGGGGCTAAGTTTTCTAGCCCTATTCCAGCCTTAAGTTGAGCTCCGGGTGCCGTCGAAGCCAGGGACCCCCTGTGCTGGCTCTTCCGTAGCGGCTAGCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.60% | 4.40% | 2.26% | 27.76% | NA |
| All Indica | 2759 | 45.90% | 7.10% | 3.59% | 43.46% | NA |
| All Japonica | 1512 | 94.60% | 0.00% | 0.20% | 5.16% | NA |
| Aus | 269 | 94.40% | 4.80% | 0.37% | 0.37% | NA |
| Indica I | 595 | 50.30% | 5.70% | 1.68% | 42.35% | NA |
| Indica II | 465 | 62.80% | 0.40% | 1.08% | 35.70% | NA |
| Indica III | 913 | 34.80% | 9.50% | 6.68% | 48.96% | NA |
| Indica Intermediate | 786 | 45.40% | 9.20% | 2.93% | 42.49% | NA |
| Temperate Japonica | 767 | 90.60% | 0.00% | 0.26% | 9.13% | NA |
| Tropical Japonica | 504 | 99.20% | 0.00% | 0.20% | 0.60% | NA |
| Japonica Intermediate | 241 | 97.90% | 0.00% | 0.00% | 2.07% | NA |
| VI/Aromatic | 96 | 75.00% | 0.00% | 4.17% | 20.83% | NA |
| Intermediate | 90 | 83.30% | 1.10% | 0.00% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0206101217 | C -> T | LOC_Os02g11800.1 | downstream_gene_variant ; 3446.0bp to feature; MODIFIER | silent_mutation | Average:26.409; most accessible tissue: Minghui63 root, score: 54.099 | N | N | N | N |
| vg0206101217 | C -> T | LOC_Os02g11790-LOC_Os02g11800 | intergenic_region ; MODIFIER | silent_mutation | Average:26.409; most accessible tissue: Minghui63 root, score: 54.099 | N | N | N | N |
| vg0206101217 | C -> DEL | N | N | silent_mutation | Average:26.409; most accessible tissue: Minghui63 root, score: 54.099 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0206101217 | NA | 2.90E-07 | Awn_length | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0206101217 | NA | 2.54E-06 | mr1125 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206101217 | NA | 3.10E-07 | mr1155 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206101217 | NA | 6.25E-06 | mr1371 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206101217 | NA | 4.08E-07 | mr1981 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |