\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0206099857:

Variant ID: vg0206099857 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 6099857
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCCACGTGGCCCTCCCCCGAGGGGAGTGAGGCCGGAGGTGGGGCGGCGGCCACTCCTTCCCAAAGACTAGTGGGGGGCACTCTAAACATGATACCCCGGG[C/T]
CCATATCACCGACAGTAGCCCCCGGCGTTAGCCCTGACCAAACCCTTTCCCAGGTGGTCAGGGTTGACGCCAATCTTCTAGTCAGTTGACATGTGGGCCC

Reverse complement sequence

GGGCCCACATGTCAACTGACTAGAAGATTGGCGTCAACCCTGACCACCTGGGAAAGGGTTTGGTCAGGGCTAACGCCGGGGGCTACTGTCGGTGATATGG[G/A]
CCCGGGGTATCATGTTTAGAGTGCCCCCCACTAGTCTTTGGGAAGGAGTGGCCGCCGCCCCACCTCCGGCCTCACTCCCCTCGGGGGAGGGCCACGTGGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.70% 32.00% 1.23% 28.04% NA
All Indica  2759 51.70% 2.30% 1.92% 44.07% NA
All Japonica  1512 3.00% 91.70% 0.13% 5.16% NA
Aus  269 98.90% 0.70% 0.00% 0.37% NA
Indica I  595 56.60% 0.80% 1.51% 41.01% NA
Indica II  465 62.80% 0.60% 1.29% 35.27% NA
Indica III  913 42.60% 3.50% 2.08% 51.81% NA
Indica Intermediate  786 51.90% 3.10% 2.42% 42.62% NA
Temperate Japonica  767 1.80% 88.80% 0.13% 9.26% NA
Tropical Japonica  504 4.40% 95.00% 0.00% 0.60% NA
Japonica Intermediate  241 4.10% 93.80% 0.41% 1.66% NA
VI/Aromatic  96 55.20% 25.00% 2.08% 17.71% NA
Intermediate  90 43.30% 41.10% 1.11% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0206099857 C -> T LOC_Os02g11790.1 upstream_gene_variant ; 3950.0bp to feature; MODIFIER silent_mutation Average:40.338; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0206099857 C -> T LOC_Os02g11800.1 downstream_gene_variant ; 4806.0bp to feature; MODIFIER silent_mutation Average:40.338; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0206099857 C -> T LOC_Os02g11790-LOC_Os02g11800 intergenic_region ; MODIFIER silent_mutation Average:40.338; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0206099857 C -> DEL N N silent_mutation Average:40.338; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0206099857 NA 3.08E-12 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206099857 NA 6.03E-15 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206099857 NA 6.52E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206099857 NA 1.22E-38 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206099857 NA 2.03E-10 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206099857 NA 2.03E-06 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206099857 NA 3.27E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206099857 NA 1.52E-07 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206099857 1.21E-06 2.52E-06 mr1768_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206099857 NA 4.11E-08 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251