\
| Variant ID: vg0206099857 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 6099857 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GCCACGTGGCCCTCCCCCGAGGGGAGTGAGGCCGGAGGTGGGGCGGCGGCCACTCCTTCCCAAAGACTAGTGGGGGGCACTCTAAACATGATACCCCGGG[C/T]
CCATATCACCGACAGTAGCCCCCGGCGTTAGCCCTGACCAAACCCTTTCCCAGGTGGTCAGGGTTGACGCCAATCTTCTAGTCAGTTGACATGTGGGCCC
GGGCCCACATGTCAACTGACTAGAAGATTGGCGTCAACCCTGACCACCTGGGAAAGGGTTTGGTCAGGGCTAACGCCGGGGGCTACTGTCGGTGATATGG[G/A]
CCCGGGGTATCATGTTTAGAGTGCCCCCCACTAGTCTTTGGGAAGGAGTGGCCGCCGCCCCACCTCCGGCCTCACTCCCCTCGGGGGAGGGCCACGTGGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.70% | 32.00% | 1.23% | 28.04% | NA |
| All Indica | 2759 | 51.70% | 2.30% | 1.92% | 44.07% | NA |
| All Japonica | 1512 | 3.00% | 91.70% | 0.13% | 5.16% | NA |
| Aus | 269 | 98.90% | 0.70% | 0.00% | 0.37% | NA |
| Indica I | 595 | 56.60% | 0.80% | 1.51% | 41.01% | NA |
| Indica II | 465 | 62.80% | 0.60% | 1.29% | 35.27% | NA |
| Indica III | 913 | 42.60% | 3.50% | 2.08% | 51.81% | NA |
| Indica Intermediate | 786 | 51.90% | 3.10% | 2.42% | 42.62% | NA |
| Temperate Japonica | 767 | 1.80% | 88.80% | 0.13% | 9.26% | NA |
| Tropical Japonica | 504 | 4.40% | 95.00% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 4.10% | 93.80% | 0.41% | 1.66% | NA |
| VI/Aromatic | 96 | 55.20% | 25.00% | 2.08% | 17.71% | NA |
| Intermediate | 90 | 43.30% | 41.10% | 1.11% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0206099857 | C -> T | LOC_Os02g11790.1 | upstream_gene_variant ; 3950.0bp to feature; MODIFIER | silent_mutation | Average:40.338; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| vg0206099857 | C -> T | LOC_Os02g11800.1 | downstream_gene_variant ; 4806.0bp to feature; MODIFIER | silent_mutation | Average:40.338; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| vg0206099857 | C -> T | LOC_Os02g11790-LOC_Os02g11800 | intergenic_region ; MODIFIER | silent_mutation | Average:40.338; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| vg0206099857 | C -> DEL | N | N | silent_mutation | Average:40.338; most accessible tissue: Minghui63 panicle, score: 77.956 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0206099857 | NA | 3.08E-12 | mr1170 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206099857 | NA | 6.03E-15 | mr1653 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206099857 | NA | 6.52E-07 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206099857 | NA | 1.22E-38 | mr1891 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206099857 | NA | 2.03E-10 | mr1379_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206099857 | NA | 2.03E-06 | mr1559_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206099857 | NA | 3.27E-08 | mr1576_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206099857 | NA | 1.52E-07 | mr1749_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206099857 | 1.21E-06 | 2.52E-06 | mr1768_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206099857 | NA | 4.11E-08 | mr1821_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |