Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0206092855:

Variant ID: vg0206092855 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 6092855
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

ACATTGGTCTAGGTATTTTTACCTAAGTTTCAACATGGACAATCCTAAAGACAAAGTTTTCACTTTGGGCCAGTTTCTTTTACCAAAAGCTTTCACTTTG[G/A]
ACTGGATGCTCTCACATGTCAGTAGATCAGGAGATAAGAGAGGACGCCGGCAAGCTTGTGATGGAGATGATTGGATTGTGGACGTCGGCAAGCTTGTAAT

Reverse complement sequence

ATTACAAGCTTGCCGACGTCCACAATCCAATCATCTCCATCACAAGCTTGCCGGCGTCCTCTCTTATCTCCTGATCTACTGACATGTGAGAGCATCCAGT[C/T]
CAAAGTGAAAGCTTTTGGTAAAAGAAACTGGCCCAAAGTGAAAACTTTGTCTTTAGGATTGTCCATGTTGAAACTTAGGTAAAAATACCTAGACCAATGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.00%	10.70%	0.80%	0.44%	NA
All Indica	2759	80.00%	17.90%	1.34%	0.76%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	59.00%	38.00%	2.18%	0.84%	NA
Indica II	465	88.00%	11.00%	0.65%	0.43%	NA
Indica III	913	87.10%	10.60%	1.31%	0.99%	NA
Indica Intermediate	786	82.80%	15.40%	1.15%	0.64%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	94.40%	5.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0206092855	G -> A	LOC_Os02g11780.1	downstream_gene_variant ; 3217.0bp to feature; MODIFIER	silent_mutation	Average:41.291; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg0206092855	G -> A	LOC_Os02g11790.1	downstream_gene_variant ; 126.0bp to feature; MODIFIER	silent_mutation	Average:41.291; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg0206092855	G -> A	LOC_Os02g11780-LOC_Os02g11790	intergenic_region ; MODIFIER	silent_mutation	Average:41.291; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N
vg0206092855	G -> DEL	N	N	silent_mutation	Average:41.291; most accessible tissue: Zhenshan97 panicle, score: 72.468	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0206092855	2.76E-06	NA	mr1714	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206092855	1.64E-06	1.64E-06	mr1714	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206092855	NA	6.43E-07	mr1255_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206092855	NA	1.67E-06	mr1257_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206092855	9.08E-06	NA	mr1714_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206092855	5.21E-06	3.93E-06	mr1714_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251