RiceVarMap2

Detailed information for vg0206054174:

Variant ID: vg0206054174 (JBrowse)

Variation Type: SNP

Chromosome: chr02

Position: 6054174

Reference Allele: C

Alternative Allele: A

Primary Allele: C

Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCAAGGATAATTATAAAAATATAAAAAGCTTTTCAAAGCACACAAAATAAATTTAATTTTAGTTTAGAATATAATACAAGATATTTTAATAAAAAGCCAC[C/A]
TACATATAAATATTCATAATAAAATTTTACTCATATTATACGAGAAGGTGCCCACGCATGTGCGCGGGCTACCTTTCTAGTTGGTTTAGAACTTCGGATA

Reverse complement sequence

TATCCGAAGTTCTAAACCAACTAGAAAGGTAGCCCGCGCACATGCGTGGGCACCTTCTCGTATAATATGAGTAAAATTTTATTATGAATATTTATATGTA[G/T]
GTGGCTTTTTATTAAAATATCTTGTATTATATTCTAAACTAAAATTAAATTTATTTTGTGTGCTTTGAAAAGCTTTTTATATTTTTATAATTATCCTTGC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.50%	32.40%	0.11%	0.00%	NA
All Indica	2759	49.60%	50.30%	0.11%	0.00%	NA
All Japonica	1512	99.20%	0.70%	0.07%	0.00%	NA
Aus	269	72.10%	27.50%	0.37%	0.00%	NA
Indica I	595	38.50%	61.50%	0.00%	0.00%	NA
Indica II	465	41.90%	57.80%	0.22%	0.00%	NA
Indica III	913	54.50%	45.20%	0.22%	0.00%	NA
Indica Intermediate	786	56.90%	43.10%	0.00%	0.00%	NA
Temperate Japonica	767	99.30%	0.70%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.20%	0.41%	0.00%	NA
VI/Aromatic	96	53.10%	46.90%	0.00%	0.00%	NA
Intermediate	90	84.40%	15.60%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0206054174	C -> A	LOC_Os02g11740.1	upstream_gene_variant ; 2926.0bp to feature; MODIFIER	silent_mutation	Average:78.471; most accessible tissue: Zhenshan97 flower, score: 91.762	N	N	N	N
vg0206054174	C -> A	LOC_Os02g11740.2	upstream_gene_variant ; 2926.0bp to feature; MODIFIER	silent_mutation	Average:78.471; most accessible tissue: Zhenshan97 flower, score: 91.762	N	N	N	N
vg0206054174	C -> A	LOC_Os02g11730-LOC_Os02g11740	intergenic_region ; MODIFIER	silent_mutation	Average:78.471; most accessible tissue: Zhenshan97 flower, score: 91.762	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0206054174	4.63E-08	4.68E-12	mr1170	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206054174	NA	5.79E-08	mr1170_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 2 of 2 entries

Previous1Next

Contact

Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China

Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/

Search for Variation information by Variation ID:

Detailed information for vg0206054174:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact