Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0206023772:

Variant ID: vg0206023772 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 6023772
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAAAAATTATGAAAAAAATTAAAAAGACAAGTCACGCATAAAATATTAATTATGTTTTATCATCTAACAACAATAAAAATAAGAATTATAAAAGAATTT[C/T]
ATATAAGACGGACAGTCAAAGTTAGACACGGAAACTCAGGGTTTGCCTTTTTTTTTTGACGGATAGAGTAGTACTACGTGCATGAATTGAATGTGGTCAA

Reverse complement sequence

TTGACCACATTCAATTCATGCACGTAGTACTACTCTATCCGTCAAAAAAAAAAGGCAAACCCTGAGTTTCCGTGTCTAACTTTGACTGTCCGTCTTATAT[G/A]
AAATTCTTTTATAATTCTTATTTTTATTGTTGTTAGATGATAAAACATAATTAATATTTTATGCGTGACTTGTCTTTTTAATTTTTTTCATAATTTTTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.40% 6.60% 0.00% 0.00% NA
All Indica  2759 96.70% 3.30% 0.00% 0.00% NA
All Japonica  1512 99.30% 0.70% 0.00% 0.00% NA
Aus  269 27.90% 72.10% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 96.50% 3.50% 0.00% 0.00% NA
Indica Intermediate  786 92.90% 7.10% 0.00% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0206023772 C -> T LOC_Os02g11700.1 upstream_gene_variant ; 4917.0bp to feature; MODIFIER silent_mutation Average:55.149; most accessible tissue: Minghui63 young leaf, score: 85.028 N N N N
vg0206023772 C -> T LOC_Os02g11710.1 upstream_gene_variant ; 535.0bp to feature; MODIFIER silent_mutation Average:55.149; most accessible tissue: Minghui63 young leaf, score: 85.028 N N N N
vg0206023772 C -> T LOC_Os02g11705.1 downstream_gene_variant ; 2512.0bp to feature; MODIFIER silent_mutation Average:55.149; most accessible tissue: Minghui63 young leaf, score: 85.028 N N N N
vg0206023772 C -> T LOC_Os02g11705-LOC_Os02g11710 intergenic_region ; MODIFIER silent_mutation Average:55.149; most accessible tissue: Minghui63 young leaf, score: 85.028 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0206023772 C T 0.17 0.07 0.08 0.05 0.06 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0206023772 NA 8.21E-08 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206023772 NA 4.02E-06 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206023772 NA 3.47E-08 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206023772 NA 1.12E-06 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206023772 NA 1.33E-07 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206023772 NA 1.13E-10 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206023772 NA 1.41E-07 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206023772 NA 1.62E-06 mr1400 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206023772 NA 9.51E-12 mr1499 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206023772 NA 5.65E-07 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206023772 NA 3.09E-11 mr1612 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206023772 NA 5.12E-06 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206023772 NA 7.41E-07 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206023772 NA 7.73E-06 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206023772 NA 1.28E-13 mr1409_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206023772 8.40E-06 1.02E-18 mr1530_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206023772 NA 6.54E-31 mr1549_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206023772 NA 1.83E-43 mr1550_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206023772 NA 6.22E-08 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206023772 NA 1.48E-07 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206023772 NA 8.56E-11 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206023772 NA 2.06E-30 mr1757_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251