\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0206023372:

Variant ID: vg0206023372 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 6023372
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, C: 0.04, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


AAGGAGGGTATAAGATTGATATTTTGGTCACCGAGTTATACTACTATTATGATTTACAAATTTATTGTTTTCATTTTACCAGTAACTTATTATCGGGAAT[T/C]
TGTTTTCTGTTTTTTTCATATCTTGTGTCGTTTAACTTTTATTAAAAATATATGGTTGTGGATGACGGATGGTGCAGGAGTTCCTTTGTTGGGGGTTCTG

Reverse complement sequence

CAGAACCCCCAACAAAGGAACTCCTGCACCATCCGTCATCCACAACCATATATTTTTAATAAAAGTTAAACGACACAAGATATGAAAAAAACAGAAAACA[A/G]
ATTCCCGATAATAAGTTACTGGTAAAATGAAAACAATAAATTTGTAAATCATAATAGTAGTATAACTCGGTGACCAAAATATCAATCTTATACCCTCCTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.60% 49.40% 0.02% 0.00% NA
All Indica  2759 18.70% 81.30% 0.00% 0.00% NA
All Japonica  1512 98.30% 1.70% 0.00% 0.00% NA
Aus  269 93.30% 6.70% 0.00% 0.00% NA
Indica I  595 34.60% 65.40% 0.00% 0.00% NA
Indica II  465 12.50% 87.50% 0.00% 0.00% NA
Indica III  913 10.00% 90.00% 0.00% 0.00% NA
Indica Intermediate  786 20.40% 79.60% 0.00% 0.00% NA
Temperate Japonica  767 98.00% 2.00% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 2.90% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 56.70% 42.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0206023372 T -> C LOC_Os02g11700.1 upstream_gene_variant ; 4517.0bp to feature; MODIFIER silent_mutation Average:50.184; most accessible tissue: Minghui63 young leaf, score: 82.642 N N N N
vg0206023372 T -> C LOC_Os02g11710.1 upstream_gene_variant ; 935.0bp to feature; MODIFIER silent_mutation Average:50.184; most accessible tissue: Minghui63 young leaf, score: 82.642 N N N N
vg0206023372 T -> C LOC_Os02g11705.1 downstream_gene_variant ; 2112.0bp to feature; MODIFIER silent_mutation Average:50.184; most accessible tissue: Minghui63 young leaf, score: 82.642 N N N N
vg0206023372 T -> C LOC_Os02g11705-LOC_Os02g11710 intergenic_region ; MODIFIER silent_mutation Average:50.184; most accessible tissue: Minghui63 young leaf, score: 82.642 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0206023372 NA 1.90E-14 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206023372 NA 1.03E-10 mr1316 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206023372 NA 3.24E-13 mr1657 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206023372 8.00E-06 1.40E-12 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206023372 1.37E-06 1.37E-06 mr1714 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206023372 NA 1.33E-11 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206023372 NA 1.96E-11 mr1883 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0206023372 1.76E-06 3.86E-06 mr1714_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251