\
| Variant ID: vg0206023372 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 6023372 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, C: 0.04, others allele: 0.00, population size: 111. )
AAGGAGGGTATAAGATTGATATTTTGGTCACCGAGTTATACTACTATTATGATTTACAAATTTATTGTTTTCATTTTACCAGTAACTTATTATCGGGAAT[T/C]
TGTTTTCTGTTTTTTTCATATCTTGTGTCGTTTAACTTTTATTAAAAATATATGGTTGTGGATGACGGATGGTGCAGGAGTTCCTTTGTTGGGGGTTCTG
CAGAACCCCCAACAAAGGAACTCCTGCACCATCCGTCATCCACAACCATATATTTTTAATAAAAGTTAAACGACACAAGATATGAAAAAAACAGAAAACA[A/G]
ATTCCCGATAATAAGTTACTGGTAAAATGAAAACAATAAATTTGTAAATCATAATAGTAGTATAACTCGGTGACCAAAATATCAATCTTATACCCTCCTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.60% | 49.40% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 18.70% | 81.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 34.60% | 65.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 12.50% | 87.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 10.00% | 90.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 20.40% | 79.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.10% | 2.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 56.70% | 42.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0206023372 | T -> C | LOC_Os02g11700.1 | upstream_gene_variant ; 4517.0bp to feature; MODIFIER | silent_mutation | Average:50.184; most accessible tissue: Minghui63 young leaf, score: 82.642 | N | N | N | N |
| vg0206023372 | T -> C | LOC_Os02g11710.1 | upstream_gene_variant ; 935.0bp to feature; MODIFIER | silent_mutation | Average:50.184; most accessible tissue: Minghui63 young leaf, score: 82.642 | N | N | N | N |
| vg0206023372 | T -> C | LOC_Os02g11705.1 | downstream_gene_variant ; 2112.0bp to feature; MODIFIER | silent_mutation | Average:50.184; most accessible tissue: Minghui63 young leaf, score: 82.642 | N | N | N | N |
| vg0206023372 | T -> C | LOC_Os02g11705-LOC_Os02g11710 | intergenic_region ; MODIFIER | silent_mutation | Average:50.184; most accessible tissue: Minghui63 young leaf, score: 82.642 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0206023372 | NA | 1.90E-14 | mr1170 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206023372 | NA | 1.03E-10 | mr1316 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206023372 | NA | 3.24E-13 | mr1657 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206023372 | 8.00E-06 | 1.40E-12 | mr1714 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206023372 | 1.37E-06 | 1.37E-06 | mr1714 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206023372 | NA | 1.33E-11 | mr1720 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206023372 | NA | 1.96E-11 | mr1883 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0206023372 | 1.76E-06 | 3.86E-06 | mr1714_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |