\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205989836:

Variant ID: vg0205989836 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 5989836
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGGAACTATACTAGAAACCCACTCAACATATCGGCAAGGACGAATAAAACCAGCATCATATAATCTTTTAATCTCAGCCTTGACCGGTTCAAGCATGTC[G/A]
GCTTTGCATCTCCTCGGAGGTTGTTGATGTGGCCTAACCCCTAGTTTGATAGGTAGCCGATGTTCAACAATCGATCAGCTGAGTCCAGGCATCTCGTAAT

Reverse complement sequence

ATTACGAGATGCCTGGACTCAGCTGATCGATTGTTGAACATCGGCTACCTATCAAACTAGGGGTTAGGCCACATCAACAACCTCCGAGGAGATGCAAAGC[C/T]
GACATGCTTGAACCGGTCAAGGCTGAGATTAAAAGATTATATGATGCTGGTTTTATTCGTCCTTGCCGATATGTTGAGTGGGTTTCTAGTATAGTTCCTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.70% 7.70% 6.77% 7.81% NA
All Indica  2759 78.90% 0.20% 8.45% 12.47% NA
All Japonica  1512 74.30% 22.00% 2.98% 0.73% NA
Aus  269 97.40% 0.00% 1.86% 0.74% NA
Indica I  595 70.80% 0.00% 16.97% 12.27% NA
Indica II  465 77.20% 0.20% 8.39% 14.19% NA
Indica III  913 86.00% 0.10% 2.52% 11.39% NA
Indica Intermediate  786 77.90% 0.40% 8.91% 12.85% NA
Temperate Japonica  767 96.20% 0.40% 2.61% 0.78% NA
Tropical Japonica  504 34.50% 61.70% 3.17% 0.60% NA
Japonica Intermediate  241 88.00% 7.50% 3.73% 0.83% NA
VI/Aromatic  96 54.20% 14.60% 25.00% 6.25% NA
Intermediate  90 64.40% 14.40% 14.44% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0205989836 G -> A LOC_Os02g11660.1 synonymous_variant ; p.Ala859Ala; LOW synonymous_codon Average:12.59; most accessible tissue: Minghui63 young leaf, score: 18.03 N N N N
vg0205989836 G -> DEL LOC_Os02g11660.1 N frameshift_variant Average:12.59; most accessible tissue: Minghui63 young leaf, score: 18.03 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0205989836 NA 8.83E-07 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836 NA 9.78E-07 mr1129 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836 NA 1.88E-07 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836 NA 8.56E-06 mr1405 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836 NA 4.99E-09 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836 NA 6.16E-11 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836 NA 2.80E-12 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836 NA 3.03E-16 mr1540 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836 NA 2.89E-06 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836 NA 3.69E-08 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836 NA 3.59E-08 mr1642 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836 NA 1.16E-08 mr1642 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836 NA 2.45E-06 mr1740 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836 NA 1.51E-06 mr1742 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836 NA 1.89E-15 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836 NA 8.67E-06 mr1990 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836 NA 7.40E-08 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836 NA 1.59E-08 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836 NA 1.87E-13 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836 NA 2.75E-07 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836 NA 4.58E-06 mr1682_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836 NA 1.17E-10 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836 NA 6.06E-08 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836 NA 7.05E-13 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836 NA 5.53E-08 mr1879_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836 NA 8.37E-09 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251