| Variant ID: vg0205989836 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 5989836 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CAGGAACTATACTAGAAACCCACTCAACATATCGGCAAGGACGAATAAAACCAGCATCATATAATCTTTTAATCTCAGCCTTGACCGGTTCAAGCATGTC[G/A]
GCTTTGCATCTCCTCGGAGGTTGTTGATGTGGCCTAACCCCTAGTTTGATAGGTAGCCGATGTTCAACAATCGATCAGCTGAGTCCAGGCATCTCGTAAT
ATTACGAGATGCCTGGACTCAGCTGATCGATTGTTGAACATCGGCTACCTATCAAACTAGGGGTTAGGCCACATCAACAACCTCCGAGGAGATGCAAAGC[C/T]
GACATGCTTGAACCGGTCAAGGCTGAGATTAAAAGATTATATGATGCTGGTTTTATTCGTCCTTGCCGATATGTTGAGTGGGTTTCTAGTATAGTTCCTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.70% | 7.70% | 6.77% | 7.81% | NA |
| All Indica | 2759 | 78.90% | 0.20% | 8.45% | 12.47% | NA |
| All Japonica | 1512 | 74.30% | 22.00% | 2.98% | 0.73% | NA |
| Aus | 269 | 97.40% | 0.00% | 1.86% | 0.74% | NA |
| Indica I | 595 | 70.80% | 0.00% | 16.97% | 12.27% | NA |
| Indica II | 465 | 77.20% | 0.20% | 8.39% | 14.19% | NA |
| Indica III | 913 | 86.00% | 0.10% | 2.52% | 11.39% | NA |
| Indica Intermediate | 786 | 77.90% | 0.40% | 8.91% | 12.85% | NA |
| Temperate Japonica | 767 | 96.20% | 0.40% | 2.61% | 0.78% | NA |
| Tropical Japonica | 504 | 34.50% | 61.70% | 3.17% | 0.60% | NA |
| Japonica Intermediate | 241 | 88.00% | 7.50% | 3.73% | 0.83% | NA |
| VI/Aromatic | 96 | 54.20% | 14.60% | 25.00% | 6.25% | NA |
| Intermediate | 90 | 64.40% | 14.40% | 14.44% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0205989836 | G -> A | LOC_Os02g11660.1 | synonymous_variant ; p.Ala859Ala; LOW | synonymous_codon | Average:12.59; most accessible tissue: Minghui63 young leaf, score: 18.03 | N | N | N | N |
| vg0205989836 | G -> DEL | LOC_Os02g11660.1 | N | frameshift_variant | Average:12.59; most accessible tissue: Minghui63 young leaf, score: 18.03 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0205989836 | NA | 8.83E-07 | mr1047 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205989836 | NA | 9.78E-07 | mr1129 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205989836 | NA | 1.88E-07 | mr1338 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205989836 | NA | 8.56E-06 | mr1405 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205989836 | NA | 4.99E-09 | mr1471 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205989836 | NA | 6.16E-11 | mr1539 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205989836 | NA | 2.80E-12 | mr1539 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205989836 | NA | 3.03E-16 | mr1540 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205989836 | NA | 2.89E-06 | mr1543 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205989836 | NA | 3.69E-08 | mr1543 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/