Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205989836:

Variant ID: vg0205989836 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 5989836
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CAGGAACTATACTAGAAACCCACTCAACATATCGGCAAGGACGAATAAAACCAGCATCATATAATCTTTTAATCTCAGCCTTGACCGGTTCAAGCATGTC[G/A]
GCTTTGCATCTCCTCGGAGGTTGTTGATGTGGCCTAACCCCTAGTTTGATAGGTAGCCGATGTTCAACAATCGATCAGCTGAGTCCAGGCATCTCGTAAT

Reverse complement sequence

ATTACGAGATGCCTGGACTCAGCTGATCGATTGTTGAACATCGGCTACCTATCAAACTAGGGGTTAGGCCACATCAACAACCTCCGAGGAGATGCAAAGC[C/T]
GACATGCTTGAACCGGTCAAGGCTGAGATTAAAAGATTATATGATGCTGGTTTTATTCGTCCTTGCCGATATGTTGAGTGGGTTTCTAGTATAGTTCCTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.70%	7.70%	6.77%	7.81%	NA
All Indica	2759	78.90%	0.20%	8.45%	12.47%	NA
All Japonica	1512	74.30%	22.00%	2.98%	0.73%	NA
Aus	269	97.40%	0.00%	1.86%	0.74%	NA
Indica I	595	70.80%	0.00%	16.97%	12.27%	NA
Indica II	465	77.20%	0.20%	8.39%	14.19%	NA
Indica III	913	86.00%	0.10%	2.52%	11.39%	NA
Indica Intermediate	786	77.90%	0.40%	8.91%	12.85%	NA
Temperate Japonica	767	96.20%	0.40%	2.61%	0.78%	NA
Tropical Japonica	504	34.50%	61.70%	3.17%	0.60%	NA
Japonica Intermediate	241	88.00%	7.50%	3.73%	0.83%	NA
VI/Aromatic	96	54.20%	14.60%	25.00%	6.25%	NA
Intermediate	90	64.40%	14.40%	14.44%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0205989836	G -> A	LOC_Os02g11660.1	synonymous_variant ; p.Ala859Ala; LOW	synonymous_codon	Average:12.59; most accessible tissue: Minghui63 young leaf, score: 18.03	N	N	N	N
vg0205989836	G -> DEL	LOC_Os02g11660.1	N	frameshift_variant	Average:12.59; most accessible tissue: Minghui63 young leaf, score: 18.03	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0205989836	NA	8.83E-07	mr1047	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836	NA	9.78E-07	mr1129	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836	NA	1.88E-07	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836	NA	8.56E-06	mr1405	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836	NA	4.99E-09	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836	NA	6.16E-11	mr1539	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836	NA	2.80E-12	mr1539	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836	NA	3.03E-16	mr1540	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836	NA	2.89E-06	mr1543	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836	NA	3.69E-08	mr1543	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836	NA	3.59E-08	mr1642	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836	NA	1.16E-08	mr1642	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836	NA	2.45E-06	mr1740	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836	NA	1.51E-06	mr1742	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836	NA	1.89E-15	mr1871	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836	NA	8.67E-06	mr1990	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836	NA	7.40E-08	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836	NA	1.59E-08	mr1543_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836	NA	1.87E-13	mr1552_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836	NA	2.75E-07	mr1653_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836	NA	4.58E-06	mr1682_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836	NA	1.17E-10	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836	NA	6.06E-08	mr1696_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836	NA	7.05E-13	mr1742_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836	NA	5.53E-08	mr1879_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205989836	NA	8.37E-09	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251