\
| Variant ID: vg0205960798 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 5960798 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 218. )
AAGGTTCAGATCATTGCTTTTGTACACGGATCATCAGTATATTGTGGAATCGATTAATTAGGATGATGTTGCTCTTTCAACCCCAACTTGTGGAGATTAT[G/A]
GGTACCCCATACCTACACGGCATGGTTATCCGACTAGTTATAGGGGATAACTTATATCTATGGAATATGTAACAGATCATGACTTGGGTATTACGTTTCC
GGAAACGTAATACCCAAGTCATGATCTGTTACATATTCCATAGATATAAGTTATCCCCTATAACTAGTCGGATAACCATGCCGTGTAGGTATGGGGTACC[C/T]
ATAATCTCCACAAGTTGGGGTTGAAAGAGCAACATCATCCTAATTAATCGATTCCACAATATACTGATGATCCGTGTACAAAAGCAATGATCTGAACCTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.60% | 6.40% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 27.50% | 72.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 6.20% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0205960798 | G -> A | LOC_Os02g11110.1 | upstream_gene_variant ; 3496.0bp to feature; MODIFIER | silent_mutation | Average:38.865; most accessible tissue: Minghui63 young leaf, score: 60.103 | N | N | N | N |
| vg0205960798 | G -> A | LOC_Os02g11120.1 | upstream_gene_variant ; 1456.0bp to feature; MODIFIER | silent_mutation | Average:38.865; most accessible tissue: Minghui63 young leaf, score: 60.103 | N | N | N | N |
| vg0205960798 | G -> A | LOC_Os02g11110.2 | upstream_gene_variant ; 3496.0bp to feature; MODIFIER | silent_mutation | Average:38.865; most accessible tissue: Minghui63 young leaf, score: 60.103 | N | N | N | N |
| vg0205960798 | G -> A | LOC_Os02g11110-LOC_Os02g11120 | intergenic_region ; MODIFIER | silent_mutation | Average:38.865; most accessible tissue: Minghui63 young leaf, score: 60.103 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0205960798 | NA | 3.51E-06 | mr1048 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 9.27E-09 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | 2.13E-06 | 8.10E-10 | mr1058 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 7.43E-08 | mr1073 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 8.97E-06 | mr1196 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 7.46E-07 | mr1206 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 1.02E-07 | mr1207 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 5.51E-06 | mr1209 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 1.22E-07 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 1.03E-09 | mr1230 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 1.90E-12 | mr1232 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 1.46E-06 | mr1262 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 5.63E-07 | mr1283 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 1.27E-06 | mr1286 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 1.67E-24 | mr1305 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 2.86E-07 | mr1314 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 3.44E-09 | mr1345 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 8.76E-07 | mr1351 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 2.22E-06 | mr1353 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 5.72E-08 | mr1365 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 7.64E-07 | mr1393 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 1.92E-06 | mr1400 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 1.53E-12 | mr1409 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 1.65E-07 | mr1417 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 1.12E-06 | mr1424 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 3.53E-06 | mr1427 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 6.36E-06 | mr1433 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 2.53E-06 | mr1434 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 8.54E-09 | mr1442 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 8.15E-07 | mr1474 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 8.15E-07 | mr1475 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | 5.97E-06 | 5.95E-06 | mr1481 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 2.93E-11 | mr1499 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 2.10E-06 | mr1512 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 2.43E-24 | mr1586 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 5.28E-06 | mr1596 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | 4.36E-06 | 4.36E-06 | mr1605 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 1.79E-07 | mr1634 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 1.71E-12 | mr1649 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 9.80E-07 | mr1652 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 2.93E-06 | mr1665 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 7.65E-11 | mr1722 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 3.58E-06 | mr1724 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 1.73E-09 | mr1730 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 1.27E-06 | mr1759 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 1.45E-07 | mr1762 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 1.17E-07 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 1.77E-08 | mr1774 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 5.66E-06 | mr1787 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 4.87E-06 | mr1791 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 6.77E-07 | mr1820 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 5.88E-06 | mr1884 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 3.66E-06 | mr1906 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 1.22E-10 | mr1939 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 7.16E-11 | mr1047_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 4.59E-13 | mr1409_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 1.59E-16 | mr1530_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 4.76E-32 | mr1549_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 1.34E-47 | mr1550_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 4.23E-07 | mr1582_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 1.18E-07 | mr1642_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 3.45E-10 | mr1649_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 1.28E-28 | mr1757_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 4.07E-06 | mr1762_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 1.47E-06 | mr1792_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205960798 | NA | 7.18E-07 | mr1815_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |