\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205949916:

Variant ID: vg0205949916 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 5949916
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


GACGGACGCCATGCCCGATTGAGATGGGGCTTACCGCCCGATTGAGATGATGGTATCCGTTCTAGTGAGTTACACTGGTGGAGAAGTGCTTTTTAGTCCC[G/A,T]
GTTTGTAACCCTCCTGTAGACCCGGTTTTCAAACCGGGACTACCAATACAGGATTAAAGATCGCTATCTTTAGTCCCGGTTCAGATACCTAGGACTAAAG

Reverse complement sequence

CTTTAGTCCTAGGTATCTGAACCGGGACTAAAGATAGCGATCTTTAATCCTGTATTGGTAGTCCCGGTTTGAAAACCGGGTCTACAGGAGGGTTACAAAC[C/T,A]
GGGACTAAAAAGCACTTCTCCACCAGTGTAACTCACTAGAACGGATACCATCATCTCAATCGGGCGGTAAGCCCCATCTCAATCGGGCATGGCGTCCGTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.40% 16.50% 0.04% 0.00% T: 0.04%
All Indica  2759 83.50% 16.30% 0.04% 0.00% T: 0.07%
All Japonica  1512 99.10% 0.90% 0.00% 0.00% NA
Aus  269 7.40% 92.20% 0.37% 0.00% NA
Indica I  595 99.20% 0.70% 0.17% 0.00% NA
Indica II  465 73.50% 26.50% 0.00% 0.00% NA
Indica III  913 82.10% 17.90% 0.00% 0.00% NA
Indica Intermediate  786 79.30% 20.50% 0.00% 0.00% T: 0.25%
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 98.40% 1.60% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 44.80% 55.20% 0.00% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0205949916 G -> A LOC_Os02g11100.1 upstream_gene_variant ; 2403.0bp to feature; MODIFIER silent_mutation Average:54.528; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg0205949916 G -> A LOC_Os02g11090.1 downstream_gene_variant ; 3593.0bp to feature; MODIFIER silent_mutation Average:54.528; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg0205949916 G -> A LOC_Os02g11090-LOC_Os02g11100 intergenic_region ; MODIFIER silent_mutation Average:54.528; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg0205949916 G -> T LOC_Os02g11100.1 upstream_gene_variant ; 2403.0bp to feature; MODIFIER silent_mutation Average:54.528; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg0205949916 G -> T LOC_Os02g11090.1 downstream_gene_variant ; 3593.0bp to feature; MODIFIER silent_mutation Average:54.528; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg0205949916 G -> T LOC_Os02g11090-LOC_Os02g11100 intergenic_region ; MODIFIER silent_mutation Average:54.528; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0205949916 NA 7.49E-06 mr1007 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205949916 NA 9.23E-13 mr1231 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205949916 NA 5.13E-11 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205949916 NA 4.71E-07 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205949916 NA 9.81E-19 mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205949916 NA 2.66E-06 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205949916 NA 8.09E-10 mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205949916 NA 1.79E-17 mr1119_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205949916 NA 2.69E-24 mr1120_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205949916 NA 8.22E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205949916 NA 4.90E-12 mr1166_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205949916 NA 1.27E-11 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205949916 NA 3.13E-25 mr1247_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205949916 NA 2.45E-06 mr1262_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205949916 NA 1.96E-19 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205949916 NA 2.12E-09 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205949916 NA 5.17E-08 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205949916 NA 4.95E-07 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205949916 NA 3.35E-09 mr1609_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205949916 NA 6.64E-07 mr1735_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205949916 NA 6.30E-10 mr1762_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205949916 NA 1.93E-08 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205949916 NA 3.23E-08 mr1805_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205949916 NA 2.51E-14 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205949916 NA 6.01E-08 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205949916 NA 2.36E-09 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205949916 NA 1.87E-15 mr1961_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251