\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205949239:

Variant ID: vg0205949239 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 5949239
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TACCAACAAATTACAACTACTTTTTCGGAAACCGATCTTCAAAGAACTTTGGACGCCAAAAAATAAGATTTATTTTTTTTGGATTATACTCATCTGTGAC[G/A]
GGCATTAACTTATTGAGATGAGTCATCTGTGACGGGCTATAGTTAATGCCCGTCACAGATAAGGGTCATCTGTGACGGGCGCTAGTTGTGGCCCGATTGA

Reverse complement sequence

TCAATCGGGCCACAACTAGCGCCCGTCACAGATGACCCTTATCTGTGACGGGCATTAACTATAGCCCGTCACAGATGACTCATCTCAATAAGTTAATGCC[C/T]
GTCACAGATGAGTATAATCCAAAAAAAATAAATCTTATTTTTTGGCGTCCAAAGTTCTTTGAAGATCGGTTTCCGAAAAAGTAGTTGTAATTTGTTGGTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.90% 24.00% 0.13% 0.00% NA
All Indica  2759 70.80% 29.00% 0.22% 0.00% NA
All Japonica  1512 98.80% 1.20% 0.00% 0.00% NA
Aus  269 8.60% 91.40% 0.00% 0.00% NA
Indica I  595 67.20% 31.90% 0.84% 0.00% NA
Indica II  465 64.10% 35.90% 0.00% 0.00% NA
Indica III  913 77.40% 22.60% 0.00% 0.00% NA
Indica Intermediate  786 69.60% 30.30% 0.13% 0.00% NA
Temperate Japonica  767 99.10% 0.90% 0.00% 0.00% NA
Tropical Japonica  504 98.40% 1.60% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 45.80% 54.20% 0.00% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0205949239 G -> A LOC_Os02g11100.1 upstream_gene_variant ; 3080.0bp to feature; MODIFIER silent_mutation Average:35.25; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0205949239 G -> A LOC_Os02g11090.1 downstream_gene_variant ; 2916.0bp to feature; MODIFIER silent_mutation Average:35.25; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0205949239 G -> A LOC_Os02g11090-LOC_Os02g11100 intergenic_region ; MODIFIER silent_mutation Average:35.25; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0205949239 NA 1.54E-06 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205949239 NA 4.64E-09 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205949239 NA 2.79E-10 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205949239 NA 4.06E-07 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205949239 NA 5.40E-17 mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205949239 NA 2.94E-15 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205949239 6.98E-07 NA mr1170_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205949239 3.65E-07 1.97E-11 mr1170_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205949239 NA 1.37E-09 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205949239 NA 7.50E-08 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251