\
| Variant ID: vg0205949239 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 5949239 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TACCAACAAATTACAACTACTTTTTCGGAAACCGATCTTCAAAGAACTTTGGACGCCAAAAAATAAGATTTATTTTTTTTGGATTATACTCATCTGTGAC[G/A]
GGCATTAACTTATTGAGATGAGTCATCTGTGACGGGCTATAGTTAATGCCCGTCACAGATAAGGGTCATCTGTGACGGGCGCTAGTTGTGGCCCGATTGA
TCAATCGGGCCACAACTAGCGCCCGTCACAGATGACCCTTATCTGTGACGGGCATTAACTATAGCCCGTCACAGATGACTCATCTCAATAAGTTAATGCC[C/T]
GTCACAGATGAGTATAATCCAAAAAAAATAAATCTTATTTTTTGGCGTCCAAAGTTCTTTGAAGATCGGTTTCCGAAAAAGTAGTTGTAATTTGTTGGTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.90% | 24.00% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 70.80% | 29.00% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 8.60% | 91.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 67.20% | 31.90% | 0.84% | 0.00% | NA |
| Indica II | 465 | 64.10% | 35.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 77.40% | 22.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 69.60% | 30.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 45.80% | 54.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 18.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0205949239 | G -> A | LOC_Os02g11100.1 | upstream_gene_variant ; 3080.0bp to feature; MODIFIER | silent_mutation | Average:35.25; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg0205949239 | G -> A | LOC_Os02g11090.1 | downstream_gene_variant ; 2916.0bp to feature; MODIFIER | silent_mutation | Average:35.25; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg0205949239 | G -> A | LOC_Os02g11090-LOC_Os02g11100 | intergenic_region ; MODIFIER | silent_mutation | Average:35.25; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0205949239 | NA | 1.54E-06 | mr1028 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205949239 | NA | 4.64E-09 | mr1170 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205949239 | NA | 2.79E-10 | mr1232 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205949239 | NA | 4.06E-07 | mr1453 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205949239 | NA | 5.40E-17 | mr1557 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205949239 | NA | 2.94E-15 | mr1653 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205949239 | 6.98E-07 | NA | mr1170_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205949239 | 3.65E-07 | 1.97E-11 | mr1170_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205949239 | NA | 1.37E-09 | mr1232_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205949239 | NA | 7.50E-08 | mr1921_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |