RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0205949239:

Variant ID: vg0205949239 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 5949239
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TACCAACAAATTACAACTACTTTTTCGGAAACCGATCTTCAAAGAACTTTGGACGCCAAAAAATAAGATTTATTTTTTTTGGATTATACTCATCTGTGAC[G/A]
GGCATTAACTTATTGAGATGAGTCATCTGTGACGGGCTATAGTTAATGCCCGTCACAGATAAGGGTCATCTGTGACGGGCGCTAGTTGTGGCCCGATTGA

Reverse complement sequence

TCAATCGGGCCACAACTAGCGCCCGTCACAGATGACCCTTATCTGTGACGGGCATTAACTATAGCCCGTCACAGATGACTCATCTCAATAAGTTAATGCC[C/T]
GTCACAGATGAGTATAATCCAAAAAAAATAAATCTTATTTTTTGGCGTCCAAAGTTCTTTGAAGATCGGTTTCCGAAAAAGTAGTTGTAATTTGTTGGTA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.90%	24.00%	0.13%	0.00%	NA
All Indica	2759	70.80%	29.00%	0.22%	0.00%	NA
All Japonica	1512	98.80%	1.20%	0.00%	0.00%	NA
Aus	269	8.60%	91.40%	0.00%	0.00%	NA
Indica I	595	67.20%	31.90%	0.84%	0.00%	NA
Indica II	465	64.10%	35.90%	0.00%	0.00%	NA
Indica III	913	77.40%	22.60%	0.00%	0.00%	NA
Indica Intermediate	786	69.60%	30.30%	0.13%	0.00%	NA
Temperate Japonica	767	99.10%	0.90%	0.00%	0.00%	NA
Tropical Japonica	504	98.40%	1.60%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	45.80%	54.20%	0.00%	0.00%	NA
Intermediate	90	81.10%	18.90%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0205949239	G -> A	LOC_Os02g11100.1	upstream_gene_variant ; 3080.0bp to feature; MODIFIER	silent_mutation	Average:35.25; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0205949239	G -> A	LOC_Os02g11090.1	downstream_gene_variant ; 2916.0bp to feature; MODIFIER	silent_mutation	Average:35.25; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0205949239	G -> A	LOC_Os02g11090-LOC_Os02g11100	intergenic_region ; MODIFIER	silent_mutation	Average:35.25; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0205949239	NA	1.54E-06	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205949239	NA	4.64E-09	mr1170	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205949239	NA	2.79E-10	mr1232	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205949239	NA	4.06E-07	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205949239	NA	5.40E-17	mr1557	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205949239	NA	2.94E-15	mr1653	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205949239	6.98E-07	NA	mr1170_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205949239	3.65E-07	1.97E-11	mr1170_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205949239	NA	1.37E-09	mr1232_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205949239	NA	7.50E-08	mr1921_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 10 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0205949239:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact