Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205917173:

Variant ID: vg0205917173 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 5917173
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 340. )

Flanking Sequence (100 bp) in Reference Genome:


TTGCCTACTTATGTCAGTAGCATGTGCCGGACATGCTACAGTGCTGCTACTGCCATGCTTTCAGGGTAGTAATCCCAGACTCTCTGTCTAGTCCGGAGGA[T/G]
AATGAATGTCAAGGGCATTAAGATAGATACATCACCCTTTCGCTCGACAAGACTTTCAAGAATTTATAGAGCATTATAGCTCTTAAATCCAGAATGCGGG

Reverse complement sequence

CCCGCATTCTGGATTTAAGAGCTATAATGCTCTATAAATTCTTGAAAGTCTTGTCGAGCGAAAGGGTGATGTATCTATCTTAATGCCCTTGACATTCATT[A/C]
TCCTCCGGACTAGACAGAGAGTCTGGGATTACTACCCTGAAAGCATGGCAGTAGCAGCACTGTAGCATGTCCGGCACATGCTACTGACATAAGTAGGCAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.30% 31.40% 0.25% 0.00% NA
All Indica  2759 99.50% 0.40% 0.07% 0.00% NA
All Japonica  1512 5.60% 93.80% 0.60% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.20% 0.22% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 98.90% 1.00% 0.13% 0.00% NA
Temperate Japonica  767 3.30% 96.30% 0.39% 0.00% NA
Tropical Japonica  504 6.30% 93.50% 0.20% 0.00% NA
Japonica Intermediate  241 11.20% 86.70% 2.07% 0.00% NA
VI/Aromatic  96 78.10% 21.90% 0.00% 0.00% NA
Intermediate  90 65.60% 33.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0205917173 T -> G LOC_Os02g11040.1 upstream_gene_variant ; 2981.0bp to feature; MODIFIER silent_mutation Average:79.514; most accessible tissue: Zhenshan97 flower, score: 94.709 N N N N
vg0205917173 T -> G LOC_Os02g11040.2 upstream_gene_variant ; 2981.0bp to feature; MODIFIER silent_mutation Average:79.514; most accessible tissue: Zhenshan97 flower, score: 94.709 N N N N
vg0205917173 T -> G LOC_Os02g11050.1 downstream_gene_variant ; 1758.0bp to feature; MODIFIER silent_mutation Average:79.514; most accessible tissue: Zhenshan97 flower, score: 94.709 N N N N
vg0205917173 T -> G LOC_Os02g11040-LOC_Os02g11050 intergenic_region ; MODIFIER silent_mutation Average:79.514; most accessible tissue: Zhenshan97 flower, score: 94.709 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0205917173 T G 0.0 -0.01 0.0 0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0205917173 NA 3.33E-22 mr1122 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205917173 NA 4.87E-44 mr1136 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205917173 NA 3.11E-14 mr1361 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205917173 NA 1.21E-22 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205917173 NA 2.44E-40 mr1480 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205917173 NA 1.64E-18 mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205917173 NA 4.00E-13 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205917173 NA 1.56E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205917173 NA 1.29E-14 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205917173 NA 2.84E-10 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205917173 NA 8.96E-52 mr1692 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205917173 NA 4.28E-21 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205917173 NA 1.12E-36 mr1944 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205917173 NA 1.15E-52 mr1136_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205917173 NA 1.84E-21 mr1175_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205917173 NA 5.26E-12 mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205917173 NA 3.83E-09 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205917173 NA 3.64E-34 mr1448_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205917173 NA 3.79E-16 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205917173 NA 3.57E-16 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251