\
| Variant ID: vg0205889382 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 5889382 |
| Reference Allele: C | Alternative Allele: A,T |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, A: 0.07, others allele: 0.00, population size: 200. )
ACCGGGACTAAAGATCAAAATTTTTATAACCGGGACTAAAAACAATCTTTAGTCCCGGTTCTTTTTGGATCCGGGACTATTGTGTATTTTGCCGGACTGA[C/A,T]
CAAAGATGGTTTCTCCACCGGTGTCAGCTACATATGACAATATGTCCAATGTTGTATTCATATAGTTCATTTACACATACCCAAAAGAGAGAATATTATC
GATAATATTCTCTCTTTTGGGTATGTGTAAATGAACTATATGAATACAACATTGGACATATTGTCATATGTAGCTGACACCGGTGGAGAAACCATCTTTG[G/T,A]
TCAGTCCGGCAAAATACACAATAGTCCCGGATCCAAAAAGAACCGGGACTAAAGATTGTTTTTAGTCCCGGTTATAAAAATTTTGATCTTTAGTCCCGGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.20% | 34.80% | 0.06% | 0.00% | T: 0.02% |
| All Indica | 2759 | 96.10% | 3.70% | 0.11% | 0.00% | T: 0.04% |
| All Japonica | 1512 | 2.40% | 97.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 90.90% | 9.10% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.00% | 1.60% | 0.22% | 0.00% | T: 0.11% |
| Indica Intermediate | 786 | 95.80% | 4.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 2.00% | 98.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 2.20% | 97.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 4.10% | 95.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 75.00% | 25.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 56.70% | 43.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0205889382 | C -> A | LOC_Os02g11020-LOC_Os02g11030 | intergenic_region ; MODIFIER | silent_mutation | Average:41.384; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg0205889382 | C -> T | LOC_Os02g11020-LOC_Os02g11030 | intergenic_region ; MODIFIER | silent_mutation | Average:41.384; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0205889382 | NA | 3.68E-07 | mr1037 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205889382 | NA | 1.42E-44 | mr1136 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205889382 | NA | 2.62E-43 | mr1194 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205889382 | NA | 6.29E-32 | mr1448 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205889382 | NA | 1.86E-43 | mr1480 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205889382 | NA | 5.21E-18 | mr1557 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205889382 | NA | 6.26E-20 | mr1627 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205889382 | NA | 3.36E-17 | mr1653 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205889382 | NA | 4.43E-52 | mr1692 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205889382 | NA | 4.73E-22 | mr1838 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205889382 | NA | 1.91E-23 | mr1839 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205889382 | NA | 3.46E-14 | mr1909 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205889382 | NA | 1.25E-10 | mr1921 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205889382 | 5.89E-07 | 1.26E-08 | mr1037_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205889382 | NA | 9.08E-13 | mr1097_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205889382 | NA | 4.59E-06 | mr1097_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205889382 | NA | 1.99E-30 | mr1102_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205889382 | NA | 5.57E-32 | mr1105_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205889382 | NA | 3.10E-55 | mr1136_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205889382 | NA | 2.54E-16 | mr1146_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205889382 | NA | 7.41E-39 | mr1152_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205889382 | NA | 1.89E-09 | mr1232_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205889382 | NA | 2.02E-20 | mr1383_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205889382 | NA | 8.47E-55 | mr1480_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205889382 | NA | 4.68E-18 | mr1557_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205889382 | NA | 2.90E-13 | mr1636_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205889382 | NA | 7.53E-13 | mr1641_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205889382 | NA | 2.03E-25 | mr1653_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205889382 | NA | 1.33E-12 | mr1714_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205889382 | NA | 3.77E-16 | mr1767_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205889382 | NA | 7.86E-11 | mr1806_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205889382 | NA | 2.54E-14 | mr1838_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205889382 | NA | 1.37E-07 | mr1909_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205889382 | NA | 6.72E-08 | mr1921_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205889382 | NA | 1.92E-22 | mr1968_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |