Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205851172:

Variant ID: vg0205851172 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 5851172
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:

TTTGCATATTTAGAAAATATACCAAACGATGAGGCTGTTAGTTTTGCAATCTTGAATACCTTAGGGATAGGGTTTGGCGAAGGCATAAGGTTTGATGCTC[C/A]
TGGAGTCCTCTTTAGCGGTGGTGGTGCAGGGGCTTGGTACTCCTGGAGCTCGGGGGAGGGGATCTACGGCGTAGCGAAGTCTGCGGTACGATGGAGAAAT

Reverse complement sequence

ATTTCTCCATCGTACCGCAGACTTCGCTACGCCGTAGATCCCCTCCCCCGAGCTCCAGGAGTACCAAGCCCCTGCACCACCACCGCTAAAGAGGACTCCA[G/T]
GAGCATCAAACCTTATGCCTTCGCCAAACCCTATCCCTAAGGTATTCAAGATTGCAAAACTAACAGCCTCATCGTTTGGTATATTTTCTAAATATGCAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.90%	2.60%	1.46%	0.00%	NA
All Indica	2759	100.00%	0.00%	0.00%	0.00%	NA
All Japonica	1512	87.40%	8.10%	4.50%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	100.00%	0.00%	0.00%	0.00%	NA
Temperate Japonica	767	93.70%	1.00%	5.22%	0.00%	NA
Tropical Japonica	504	87.70%	11.50%	0.79%	0.00%	NA
Japonica Intermediate	241	66.80%	23.20%	9.96%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	1.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0205851172	C -> A	LOC_Os02g11000.1	downstream_gene_variant ; 4027.0bp to feature; MODIFIER	silent_mutation	Average:68.6; most accessible tissue: Minghui63 panicle, score: 91.41	N	N	N	N
vg0205851172	C -> A	LOC_Os02g11010.1	downstream_gene_variant ; 684.0bp to feature; MODIFIER	silent_mutation	Average:68.6; most accessible tissue: Minghui63 panicle, score: 91.41	N	N	N	N
vg0205851172	C -> A	LOC_Os02g11000.3	downstream_gene_variant ; 3575.0bp to feature; MODIFIER	silent_mutation	Average:68.6; most accessible tissue: Minghui63 panicle, score: 91.41	N	N	N	N
vg0205851172	C -> A	LOC_Os02g11000.2	downstream_gene_variant ; 3575.0bp to feature; MODIFIER	silent_mutation	Average:68.6; most accessible tissue: Minghui63 panicle, score: 91.41	N	N	N	N
vg0205851172	C -> A	LOC_Os02g11000-LOC_Os02g11010	intergenic_region ; MODIFIER	silent_mutation	Average:68.6; most accessible tissue: Minghui63 panicle, score: 91.41	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0205851172	5.49E-06	5.49E-06	mr1037	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205851172	1.32E-06	1.32E-06	mr1067_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205851172	5.69E-06	5.69E-06	mr1299_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205851172	2.48E-06	2.47E-06	mr1312_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205851172	4.50E-08	4.50E-08	mr1634_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205851172	NA	1.36E-06	mr1665_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205851172	7.21E-06	7.21E-06	mr1687_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205851172	3.26E-06	3.26E-06	mr1700_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205851172	NA	1.54E-06	mr1738_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205851172	8.08E-07	4.16E-07	mr1750_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205851172	NA	9.62E-06	mr1833_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251