Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0205760250:

Variant ID: vg0205760250 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 5760250
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

TGGGCGTCCTGTGGAACTGGAGCAGCGCCGGGAAGAAGGCGTGGCCCTTGAGCTGGTTCGTGCCGTTGGTCAACATGAGCAGCCCGTTCGGGGTCACCGT[C/T]
GCCATGCCATCGAAGCTGAGATTCGCGGCGGTGAACCCGTTGAGGACAAACTTCTCGTCGCCCTCCGCCTCCCGCAAACCTCCGCAGCCCGCTGGTGCCG

Reverse complement sequence

CGGCACCAGCGGGCTGCGGAGGTTTGCGGGAGGCGGAGGGCGACGAGAAGTTTGTCCTCAACGGGTTCACCGCCGCGAATCTCAGCTTCGATGGCATGGC[G/A]
ACGGTGACCCCGAACGGGCTGCTCATGTTGACCAACGGCACGAACCAGCTCAAGGGCCACGCCTTCTTCCCGGCGCTGCTCCAGTTCCACAGGACGCCCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.50%	17.10%	0.08%	0.28%	NA
All Indica	2759	99.80%	0.20%	0.00%	0.00%	NA
All Japonica	1512	47.70%	51.50%	0.26%	0.60%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.70%	0.30%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.30%	0.00%	0.00%	NA
Temperate Japonica	767	44.90%	54.60%	0.52%	0.00%	NA
Tropical Japonica	504	61.70%	36.70%	0.00%	1.59%	NA
Japonica Intermediate	241	27.40%	72.20%	0.00%	0.41%	NA
VI/Aromatic	96	84.40%	14.60%	0.00%	1.04%	NA
Intermediate	90	84.40%	12.20%	0.00%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0205760250	C -> T	LOC_Os02g10860.1	synonymous_variant ; p.Ala289Ala; LOW	synonymous_codon	Average:83.549; most accessible tissue: Minghui63 flag leaf, score: 91.886	N	N	N	N
vg0205760250	C -> DEL	LOC_Os02g10860.1	N	frameshift_variant	Average:83.549; most accessible tissue: Minghui63 flag leaf, score: 91.886	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0205760250	C	T	-0.01	-0.01	-0.02	-0.01	-0.01	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0205760250	NA	1.05E-08	mr1302	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205760250	NA	5.78E-07	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205760250	NA	3.03E-07	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205760250	NA	6.68E-07	mr1418	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205760250	NA	1.99E-06	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205760250	NA	5.37E-09	mr1488	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205760250	NA	6.25E-09	mr1575	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205760250	NA	6.42E-08	mr1604	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205760250	NA	2.17E-06	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205760250	NA	1.45E-06	mr1633	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205760250	NA	6.60E-07	mr1646	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205760250	NA	7.63E-07	mr1797	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205760250	NA	7.63E-07	mr1801	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205760250	NA	5.19E-07	mr1810	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205760250	NA	9.76E-06	mr1884	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205760250	1.05E-11	NA	mr1136_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205760250	3.94E-07	NA	mr1136_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251