\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205760250:

Variant ID: vg0205760250 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 5760250
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


TGGGCGTCCTGTGGAACTGGAGCAGCGCCGGGAAGAAGGCGTGGCCCTTGAGCTGGTTCGTGCCGTTGGTCAACATGAGCAGCCCGTTCGGGGTCACCGT[C/T]
GCCATGCCATCGAAGCTGAGATTCGCGGCGGTGAACCCGTTGAGGACAAACTTCTCGTCGCCCTCCGCCTCCCGCAAACCTCCGCAGCCCGCTGGTGCCG

Reverse complement sequence

CGGCACCAGCGGGCTGCGGAGGTTTGCGGGAGGCGGAGGGCGACGAGAAGTTTGTCCTCAACGGGTTCACCGCCGCGAATCTCAGCTTCGATGGCATGGC[G/A]
ACGGTGACCCCGAACGGGCTGCTCATGTTGACCAACGGCACGAACCAGCTCAAGGGCCACGCCTTCTTCCCGGCGCTGCTCCAGTTCCACAGGACGCCCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.50% 17.10% 0.08% 0.28% NA
All Indica  2759 99.80% 0.20% 0.00% 0.00% NA
All Japonica  1512 47.70% 51.50% 0.26% 0.60% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.30% 0.00% 0.00% NA
Temperate Japonica  767 44.90% 54.60% 0.52% 0.00% NA
Tropical Japonica  504 61.70% 36.70% 0.00% 1.59% NA
Japonica Intermediate  241 27.40% 72.20% 0.00% 0.41% NA
VI/Aromatic  96 84.40% 14.60% 0.00% 1.04% NA
Intermediate  90 84.40% 12.20% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0205760250 C -> T LOC_Os02g10860.1 synonymous_variant ; p.Ala289Ala; LOW synonymous_codon Average:83.549; most accessible tissue: Minghui63 flag leaf, score: 91.886 N N N N
vg0205760250 C -> DEL LOC_Os02g10860.1 N frameshift_variant Average:83.549; most accessible tissue: Minghui63 flag leaf, score: 91.886 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0205760250 C T -0.01 -0.01 -0.02 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0205760250 NA 1.05E-08 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205760250 NA 5.78E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205760250 NA 3.03E-07 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205760250 NA 6.68E-07 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205760250 NA 1.99E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205760250 NA 5.37E-09 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205760250 NA 6.25E-09 mr1575 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205760250 NA 6.42E-08 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205760250 NA 2.17E-06 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205760250 NA 1.45E-06 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205760250 NA 6.60E-07 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205760250 NA 7.63E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205760250 NA 7.63E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205760250 NA 5.19E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205760250 NA 9.76E-06 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205760250 1.05E-11 NA mr1136_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205760250 3.94E-07 NA mr1136_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251