Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205737044:

Variant ID: vg0205737044 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 5737044
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.83, A: 0.18, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


TCCCTCGCCGGACGGCTGCGCCGCCGCTGTTCGCCAGCGTCGGGCTCAGCTTGCCGTCTGCGGCGAAGGGCCGGGACAACTGCGACGTCGCGCGGCAGCT[C/A]
GCCGCCGCGGAGGCCGAGGAGGCGGCGGGGAAGAAGAGGCAGGGCAGGAAGATGAAGGGCGGCGGCGGGCTGCTGTCGCTGAGGAAGGTGAGGGTGAAGA

Reverse complement sequence

TCTTCACCCTCACCTTCCTCAGCGACAGCAGCCCGCCGCCGCCCTTCATCTTCCTGCCCTGCCTCTTCTTCCCCGCCGCCTCCTCGGCCTCCGCGGCGGC[G/T]
AGCTGCCGCGCGACGTCGCAGTTGTCCCGGCCCTTCGCCGCAGACGGCAAGCTGAGCCCGACGCTGGCGAACAGCGGCGGCGCAGCCGTCCGGCGAGGGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.70% 44.20% 0.08% 0.00% NA
All Indica  2759 91.20% 8.70% 0.11% 0.00% NA
All Japonica  1512 1.70% 98.30% 0.00% 0.00% NA
Aus  269 3.30% 96.70% 0.00% 0.00% NA
Indica I  595 98.00% 2.00% 0.00% 0.00% NA
Indica II  465 96.30% 3.40% 0.22% 0.00% NA
Indica III  913 88.40% 11.50% 0.11% 0.00% NA
Indica Intermediate  786 86.40% 13.50% 0.13% 0.00% NA
Temperate Japonica  767 2.10% 97.90% 0.00% 0.00% NA
Tropical Japonica  504 0.80% 99.20% 0.00% 0.00% NA
Japonica Intermediate  241 2.50% 97.50% 0.00% 0.00% NA
VI/Aromatic  96 38.50% 60.40% 1.04% 0.00% NA
Intermediate  90 46.70% 53.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0205737044 C -> A LOC_Os02g10800.1 synonymous_variant ; p.Leu89Leu; LOW synonymous_codon Average:80.159; most accessible tissue: Zhenshan97 flag leaf, score: 91.143 N N N N
vg0205737044 C -> A LOC_Os02g10800.3 synonymous_variant ; p.Leu89Leu; LOW synonymous_codon Average:80.159; most accessible tissue: Zhenshan97 flag leaf, score: 91.143 N N N N
vg0205737044 C -> A LOC_Os02g10800.2 synonymous_variant ; p.Leu89Leu; LOW synonymous_codon Average:80.159; most accessible tissue: Zhenshan97 flag leaf, score: 91.143 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0205737044 C A 0.0 0.0 0.0 -0.01 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0205737044 NA 6.84E-49 mr1063 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205737044 NA 1.43E-41 mr1089 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205737044 NA 1.06E-48 mr1125 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205737044 NA 7.83E-36 mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205737044 NA 1.69E-20 mr1131 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205737044 NA 3.47E-13 mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205737044 NA 2.41E-16 mr1147 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205737044 NA 2.82E-14 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205737044 NA 7.37E-16 mr1199 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205737044 NA 1.34E-24 mr1251 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205737044 NA 9.44E-21 mr1253 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205737044 NA 3.19E-18 mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205737044 NA 2.78E-33 mr1257 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205737044 NA 3.90E-12 mr1260 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205737044 NA 9.68E-17 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205737044 NA 2.46E-09 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205737044 NA 3.71E-37 mr1435 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205737044 NA 3.24E-39 mr1437 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205737044 NA 2.95E-14 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205737044 NA 7.41E-18 mr1552 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205737044 NA 4.82E-11 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205737044 NA 7.88E-51 mr1798 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205737044 NA 2.32E-16 mr1807 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205737044 NA 6.68E-11 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205737044 NA 2.12E-17 mr1870 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205737044 NA 4.00E-18 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205737044 NA 4.51E-16 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205737044 NA 1.82E-08 mr1929 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205737044 NA 8.78E-54 mr1063_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205737044 NA 2.61E-37 mr1129_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205737044 NA 1.64E-12 mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205737044 NA 4.28E-33 mr1161_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205737044 NA 1.53E-21 mr1164_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205737044 NA 6.25E-18 mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205737044 NA 2.69E-23 mr1183_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205737044 NA 1.45E-24 mr1253_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205737044 NA 1.55E-19 mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205737044 NA 3.08E-35 mr1257_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205737044 NA 1.20E-09 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205737044 NA 1.65E-72 mr1798_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205737044 NA 1.57E-13 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205737044 NA 5.05E-20 mr1870_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205737044 NA 7.88E-31 mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251