\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205733501:

Variant ID: vg0205733501 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 5733501
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, A: 0.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


TAAGCAATCGGCTATATGTCCAATGTAGATAATGATATAAAGACAATCGGTTGATGATGATGTATATAACAATATGATCCAATATAAACCAATCGGCAAA[A/T]
AATGATATGATAAATAAGCATCGATTCGAAGGTTAAAGCATACATCAGCTGGAGATCCGATGTTATAAAATCCACAAGATTATATTAAACAATTAAATCT

Reverse complement sequence

AGATTTAATTGTTTAATATAATCTTGTGGATTTTATAACATCGGATCTCCAGCTGATGTATGCTTTAACCTTCGAATCGATGCTTATTTATCATATCATT[T/A]
TTTGCCGATTGGTTTATATTGGATCATATTGTTATATACATCATCATCAACCGATTGTCTTTATATCATTATCTACATTGGACATATAGCCGATTGCTTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.50% 30.40% 0.02% 0.00% NA
All Indica  2759 68.80% 31.20% 0.04% 0.00% NA
All Japonica  1512 86.20% 13.80% 0.00% 0.00% NA
Aus  269 0.40% 99.60% 0.00% 0.00% NA
Indica I  595 68.60% 31.40% 0.00% 0.00% NA
Indica II  465 79.40% 20.60% 0.00% 0.00% NA
Indica III  913 70.10% 29.90% 0.00% 0.00% NA
Indica Intermediate  786 61.10% 38.80% 0.13% 0.00% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 61.50% 38.50% 0.00% 0.00% NA
Japonica Intermediate  241 95.40% 4.60% 0.00% 0.00% NA
VI/Aromatic  96 21.90% 78.10% 0.00% 0.00% NA
Intermediate  90 71.10% 28.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0205733501 A -> T LOC_Os02g10794.1 upstream_gene_variant ; 1329.0bp to feature; MODIFIER silent_mutation Average:42.425; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg0205733501 A -> T LOC_Os02g10800.1 upstream_gene_variant ; 3105.0bp to feature; MODIFIER silent_mutation Average:42.425; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg0205733501 A -> T LOC_Os02g10800.3 upstream_gene_variant ; 3103.0bp to feature; MODIFIER silent_mutation Average:42.425; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg0205733501 A -> T LOC_Os02g10800.2 upstream_gene_variant ; 3104.0bp to feature; MODIFIER silent_mutation Average:42.425; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg0205733501 A -> T LOC_Os02g10794-LOC_Os02g10800 intergenic_region ; MODIFIER silent_mutation Average:42.425; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0205733501 NA 1.05E-07 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205733501 NA 6.01E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205733501 NA 1.80E-08 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205733501 NA 4.27E-07 mr1153 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205733501 NA 5.41E-08 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205733501 NA 3.26E-07 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205733501 2.97E-06 NA mr1263 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205733501 NA 4.46E-06 mr1266 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205733501 NA 1.13E-06 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205733501 NA 9.93E-06 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205733501 NA 2.03E-07 mr1373 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205733501 NA 6.66E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205733501 2.97E-06 NA mr1451 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205733501 NA 1.18E-07 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205733501 NA 6.34E-06 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205733501 NA 5.43E-06 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205733501 NA 6.44E-12 mr1522 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205733501 NA 3.07E-09 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205733501 NA 4.61E-07 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205733501 NA 3.36E-10 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205733501 NA 2.37E-06 mr1948 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251