Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205733501:

Variant ID: vg0205733501 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 5733501
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, A: 0.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:

TAAGCAATCGGCTATATGTCCAATGTAGATAATGATATAAAGACAATCGGTTGATGATGATGTATATAACAATATGATCCAATATAAACCAATCGGCAAA[A/T]
AATGATATGATAAATAAGCATCGATTCGAAGGTTAAAGCATACATCAGCTGGAGATCCGATGTTATAAAATCCACAAGATTATATTAAACAATTAAATCT

Reverse complement sequence

AGATTTAATTGTTTAATATAATCTTGTGGATTTTATAACATCGGATCTCCAGCTGATGTATGCTTTAACCTTCGAATCGATGCTTATTTATCATATCATT[T/A]
TTTGCCGATTGGTTTATATTGGATCATATTGTTATATACATCATCATCAACCGATTGTCTTTATATCATTATCTACATTGGACATATAGCCGATTGCTTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.50%	30.40%	0.02%	0.00%	NA
All Indica	2759	68.80%	31.20%	0.04%	0.00%	NA
All Japonica	1512	86.20%	13.80%	0.00%	0.00%	NA
Aus	269	0.40%	99.60%	0.00%	0.00%	NA
Indica I	595	68.60%	31.40%	0.00%	0.00%	NA
Indica II	465	79.40%	20.60%	0.00%	0.00%	NA
Indica III	913	70.10%	29.90%	0.00%	0.00%	NA
Indica Intermediate	786	61.10%	38.80%	0.13%	0.00%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	61.50%	38.50%	0.00%	0.00%	NA
Japonica Intermediate	241	95.40%	4.60%	0.00%	0.00%	NA
VI/Aromatic	96	21.90%	78.10%	0.00%	0.00%	NA
Intermediate	90	71.10%	28.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0205733501	A -> T	LOC_Os02g10794.1	upstream_gene_variant ; 1329.0bp to feature; MODIFIER	silent_mutation	Average:42.425; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N
vg0205733501	A -> T	LOC_Os02g10800.1	upstream_gene_variant ; 3105.0bp to feature; MODIFIER	silent_mutation	Average:42.425; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N
vg0205733501	A -> T	LOC_Os02g10800.3	upstream_gene_variant ; 3103.0bp to feature; MODIFIER	silent_mutation	Average:42.425; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N
vg0205733501	A -> T	LOC_Os02g10800.2	upstream_gene_variant ; 3104.0bp to feature; MODIFIER	silent_mutation	Average:42.425; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N
vg0205733501	A -> T	LOC_Os02g10794-LOC_Os02g10800	intergenic_region ; MODIFIER	silent_mutation	Average:42.425; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0205733501	NA	1.05E-07	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205733501	NA	6.01E-06	mr1066	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205733501	NA	1.80E-08	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205733501	NA	4.27E-07	mr1153	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205733501	NA	5.41E-08	mr1190	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205733501	NA	3.26E-07	mr1227	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205733501	2.97E-06	NA	mr1263	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205733501	NA	4.46E-06	mr1266	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205733501	NA	1.13E-06	mr1286	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205733501	NA	9.93E-06	mr1331	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205733501	NA	2.03E-07	mr1373	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205733501	NA	6.66E-06	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205733501	2.97E-06	NA	mr1451	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205733501	NA	1.18E-07	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205733501	NA	6.34E-06	mr1512	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205733501	NA	5.43E-06	mr1516	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205733501	NA	6.44E-12	mr1522	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205733501	NA	3.07E-09	mr1570	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205733501	NA	4.61E-07	mr1652	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205733501	NA	3.36E-10	mr1921	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205733501	NA	2.37E-06	mr1948	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251