\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0205731162:

Variant ID: vg0205731162 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 5731162
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.07, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


TATCTTAAGCATAAAAAGAGTGGTGTCATAAGCCATGTTGATGCTTACTGTATTTGAAGCACAACAGTAATTTCTAACGGTTCTTTGGTTGGCCAGTATC[A/G]
ATTAAAAAAATCAACAAGCTCTAGTCTTAATTTTACTTCACTGTGTTAATTAGCATTTGTTTTGAGGGAAATAGGCACCTAAAGCAAGTAGTGTCATATG

Reverse complement sequence

CATATGACACTACTTGCTTTAGGTGCCTATTTCCCTCAAAACAAATGCTAATTAACACAGTGAAGTAAAATTAAGACTAGAGCTTGTTGATTTTTTTAAT[T/C]
GATACTGGCCAACCAAAGAACCGTTAGAAATTACTGTTGTGCTTCAAATACAGTAAGCATCAACATGGCTTATGACACCACTCTTTTTATGCTTAAGATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.20% 36.80% 0.06% 0.00% NA
All Indica  2759 96.10% 3.90% 0.00% 0.00% NA
All Japonica  1512 14.60% 85.30% 0.07% 0.00% NA
Aus  269 3.30% 96.70% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 96.30% 3.70% 0.00% 0.00% NA
Indica Intermediate  786 91.70% 8.30% 0.00% 0.00% NA
Temperate Japonica  767 2.20% 97.80% 0.00% 0.00% NA
Tropical Japonica  504 38.30% 61.70% 0.00% 0.00% NA
Japonica Intermediate  241 4.60% 95.00% 0.41% 0.00% NA
VI/Aromatic  96 56.20% 43.80% 0.00% 0.00% NA
Intermediate  90 56.70% 41.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0205731162 A -> G LOC_Os02g10794.1 intron_variant ; MODIFIER silent_mutation Average:44.559; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0205731162 NA 1.07E-13 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205731162 NA 1.25E-12 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205731162 NA 1.72E-44 mr1089 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205731162 NA 1.03E-47 mr1125 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205731162 NA 2.41E-39 mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205731162 NA 1.80E-16 mr1147 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205731162 NA 1.63E-13 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205731162 NA 3.53E-26 mr1251 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205731162 NA 1.89E-18 mr1253 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205731162 NA 1.20E-18 mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205731162 NA 9.92E-36 mr1257 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205731162 NA 3.95E-09 mr1260 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205731162 NA 2.20E-15 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205731162 NA 5.11E-14 mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205731162 NA 5.08E-11 mr1316 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205731162 NA 1.23E-40 mr1435 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205731162 NA 1.62E-13 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205731162 NA 1.88E-30 mr1638 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205731162 NA 3.60E-10 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205731162 NA 1.32E-32 mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205731162 NA 9.09E-15 mr1807 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205731162 NA 7.99E-18 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205731162 NA 6.26E-57 mr1089_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205731162 NA 8.73E-55 mr1109_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205731162 NA 4.19E-42 mr1129_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205731162 NA 6.82E-16 mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205731162 NA 6.00E-21 mr1183_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205731162 NA 1.17E-39 mr1251_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205731162 NA 4.20E-27 mr1253_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205731162 NA 1.28E-21 mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205731162 NA 8.02E-40 mr1257_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205731162 NA 8.11E-40 mr1435_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205731162 NA 3.69E-11 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205731162 NA 1.11E-14 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205731162 NA 1.34E-39 mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205731162 NA 1.57E-13 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0205731162 NA 4.45E-31 mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251