\
| Variant ID: vg0205657255 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 5657255 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTCCTGTTTTATGTGATGAGCGTAGATAGGATGGTATAAGGTTTTTTTTCTTTTTGACATAACTCAAACTCTGGAAGTTGAACTTTTTTTAAGACGGAGA[G/A]
AGTAGATGGTTAATATAATACTAAATTAAATCACAATATCCATAAATACAATATTGTGTGTATCTTTGGTGAATGCAAAGGCTGAAAATTACTTCTTTTG
CAAAAGAAGTAATTTTCAGCCTTTGCATTCACCAAAGATACACACAATATTGTATTTATGGATATTGTGATTTAATTTAGTATTATATTAACCATCTACT[C/T]
TCTCCGTCTTAAAAAAAGTTCAACTTCCAGAGTTTGAGTTATGTCAAAAAGAAAAAAAACCTTATACCATCCTATCTACGCTCATCACATAAAACAGGAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.50% | 13.50% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 89.50% | 10.40% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 88.40% | 11.60% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 86.40% | 13.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 89.60% | 10.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 39.60% | 60.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0205657255 | G -> A | LOC_Os02g10730.1 | upstream_gene_variant ; 1761.0bp to feature; MODIFIER | silent_mutation | Average:41.675; most accessible tissue: Callus, score: 65.522 | N | N | N | N |
| vg0205657255 | G -> A | LOC_Os02g10730-LOC_Os02g10740 | intergenic_region ; MODIFIER | silent_mutation | Average:41.675; most accessible tissue: Callus, score: 65.522 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0205657255 | NA | 2.12E-06 | mr1006 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205657255 | NA | 1.66E-06 | mr1052 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205657255 | NA | 3.44E-06 | mr1073 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205657255 | NA | 5.60E-13 | mr1522 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205657255 | NA | 9.47E-16 | mr1765 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205657255 | NA | 6.98E-13 | mr1918 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205657255 | NA | 2.60E-08 | mr1929 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205657255 | 2.62E-06 | NA | mr1037_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205657255 | 2.86E-06 | 3.98E-08 | mr1037_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205657255 | NA | 6.77E-06 | mr1096_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205657255 | NA | 5.00E-07 | mr1126_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205657255 | NA | 9.27E-09 | mr1166_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205657255 | NA | 1.03E-06 | mr1929_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |