Variant ID: vg0205621590 (JBrowse) | Variation Type: SNP |
Chromosome: chr02 | Position: 5621590 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATCTCCGGCGAAGGGATAAGTCCAATGTTCCGCCGGTCCAGGCAATTGTATCGTCTACGTCGGCGTCGTTCAAGACTGCATCAATACATTCGACCTCTTG[G/A]
ATTGCTCTGGTTTGGATGATATATTTACCTACCTATTTATCATATGTCTCTGATAATCTAGTCTTAGTATGTCAATTTAGCTCTATCGACTGCTTCTCGT
ACGAGAAGCAGTCGATAGAGCTAAATTGACATACTAAGACTAGATTATCAGAGACATATGATAAATAGGTAGGTAAATATATCATCCAAACCAGAGCAAT[C/T]
CAAGAGGTCGAATGTATTGATGCAGTCTTGAACGACGCCGACGTAGACGATACAATTGCCTGGACCGGCGGAACATTGGACTTATCCCTTCGCCGGAGAT
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 90.80% | 9.20% | 0.06% | 0.00% | NA |
All Indica | 2759 | 85.10% | 14.90% | 0.07% | 0.00% | NA |
All Japonica | 1512 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Aus | 269 | 93.70% | 5.90% | 0.37% | 0.00% | NA |
Indica I | 595 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 84.10% | 15.90% | 0.00% | 0.00% | NA |
Indica III | 913 | 78.80% | 21.20% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 83.20% | 16.50% | 0.25% | 0.00% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0205621590 | G -> A | LOC_Os02g10690.1 | upstream_gene_variant ; 1762.0bp to feature; MODIFIER | silent_mutation | Average:43.707; most accessible tissue: Zhenshan97 flag leaf, score: 75.455 | N | N | N | N |
vg0205621590 | G -> A | LOC_Os02g10690.2 | upstream_gene_variant ; 1762.0bp to feature; MODIFIER | silent_mutation | Average:43.707; most accessible tissue: Zhenshan97 flag leaf, score: 75.455 | N | N | N | N |
vg0205621590 | G -> A | LOC_Os02g10670.1 | downstream_gene_variant ; 1639.0bp to feature; MODIFIER | silent_mutation | Average:43.707; most accessible tissue: Zhenshan97 flag leaf, score: 75.455 | N | N | N | N |
vg0205621590 | G -> A | LOC_Os02g10680.1 | downstream_gene_variant ; 932.0bp to feature; MODIFIER | silent_mutation | Average:43.707; most accessible tissue: Zhenshan97 flag leaf, score: 75.455 | N | N | N | N |
vg0205621590 | G -> A | LOC_Os02g10670-LOC_Os02g10680 | intergenic_region ; MODIFIER | silent_mutation | Average:43.707; most accessible tissue: Zhenshan97 flag leaf, score: 75.455 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0205621590 | NA | 2.11E-07 | mr1619_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0205621590 | 4.83E-06 | NA | mr1705_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0205621590 | NA | 8.70E-07 | mr1705_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |