\
| Variant ID: vg0205588537 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 5588537 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.02, others allele: 0.00, population size: 286. )
ACTCACGGGCTGTAGCCAGATGCTTTTGCAAGTGCATCATATGAGTTCCAATTATGCTGTTTATTGACTAGAGAGAAAAACTTACATCAACAGAAAGAAC[C/T]
GCCGAGTAGACTTCTGACATTTTCACATCTTCATTGGCTAATAGAGAACCTTCTTCACAAGGGAGCTGTTTCAGTTCAGAATTTTTGTCAATCATCTCTC
GAGAGATGATTGACAAAAATTCTGAACTGAAACAGCTCCCTTGTGAAGAAGGTTCTCTATTAGCCAATGAAGATGTGAAAATGTCAGAAGTCTACTCGGC[G/A]
GTTCTTTCTGTTGATGTAAGTTTTTCTCTCTAGTCAATAAACAGCATAATTGGAACTCATATGATGCACTTGCAAAAGCATCTGGCTACAGCCCGTGAGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.20% | 44.80% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 88.60% | 11.30% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 2.90% | 97.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 27.90% | 72.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 70.30% | 29.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 93.50% | 6.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 85.10% | 14.60% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 2.20% | 97.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 9.10% | 90.50% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 9.40% | 90.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 40.00% | 60.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0205588537 | C -> T | LOC_Os02g10630.1 | synonymous_variant ; p.Ala949Ala; LOW | synonymous_codon | Average:66.153; most accessible tissue: Callus, score: 85.966 | N | N | N | N |
| vg0205588537 | C -> T | LOC_Os02g10630.1 | synonymous_variant ; p.Ala949Ala; LOW | nonsynonymous_codon ; A949V | Average:66.153; most accessible tissue: Callus, score: 85.966 | benign |
0.217 |
TOLERATED | 0.05 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0205588537 | NA | 1.08E-14 | mr1032 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205588537 | NA | 8.34E-07 | mr1032 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205588537 | NA | 3.23E-19 | mr1077 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205588537 | NA | 1.27E-08 | mr1170 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205588537 | NA | 1.51E-14 | mr1478 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205588537 | NA | 3.39E-06 | mr1478 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205588537 | NA | 8.83E-06 | mr1553 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205588537 | NA | 9.99E-08 | mr1836 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205588537 | NA | 1.83E-15 | mr1148_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205588537 | NA | 8.99E-19 | mr1165_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205588537 | NA | 1.12E-06 | mr1170_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205588537 | 4.47E-08 | NA | mr1180_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205588537 | NA | 3.34E-07 | mr1321_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205588537 | NA | 4.63E-10 | mr1478_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205588537 | NA | 8.58E-06 | mr1648_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205588537 | NA | 4.28E-09 | mr1660_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0205588537 | NA | 4.21E-07 | mr1668_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |